1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luden [163]
3 years ago
7

What are the weighting laws?

Chemistry
1 answer:
lora16 [44]3 years ago
8 0

Answer: A comprehensive legal term for uniform standards ascribed to the quantity, capacity, volume, or dimensions of anything. Legislation that adopts and mandates the use of a uniform system of weights and measures is a valid exercise of Police Power, and such laws are constitutional.

Explanation:

You might be interested in
In order from lowest to highest frequency,list the different waves of the electromagnetic spectrum
hoa [83]

radio waves

infrared radiation

visible light

ultraviolet radiation

X-rays

gamma rays

7 0
3 years ago
Read 2 more answers
Question 9 rank the effective nuclear charge z * experienced by a valence electron in each of these atoms:
AlexFokin [52]
To rank the effective nuclear charge Z* experienced by a valence electrons of a set of atoms that belong to a same period, you only need to apply the rule of trend: it increases as you move from left to right in the period.

So, lets do it for these atoms: P,  Al, Si, Cl

The belong to a same period and the order is Al, Si, P, Cl (just see a periodic table). So the rank is Al < Si < P < Cl

Now, lets do it for these atoms:, Be, Ne, O, C

They belong to the second period. The order is Be, C, O, Ne

So, the rank is Be < C < O < Ne.


7 0
3 years ago
What are some examples of fusion
sveticcg [70]

Answer:

Example of a fusion dish: combination of smoked salmon wrapped in rice paper, with avocado, cucumber and crab sticks. Fusion cuisine is cuisine that combines elements of different culinary traditions that originate from different countries, regions, or cultures.

3 0
3 years ago
Why is graphite used instead of gold or copper wires to conduct electricity in very hot situations such as an industrial kiln?
olga2289 [7]
<span>The strong bonds give graphite high boiling and melting points, while the weak bonds make graphite soft and flexible.</span>
5 0
3 years ago
Read 2 more answers
What three facts made Pluto difficult to find?
BigorU [14]
1 Its low gravitational influence.
2 Its extremely faint, compared to all the other objects out there.
3 Its Size
6 0
3 years ago
Read 2 more answers
Other questions:
  • Why is BrCl5 nonpolar when it's Asymmetrical? Aren't symmetrical molecules suppposed to be polar?
    12·2 answers
  • How does dalton's atomic theory account for the law of mass conservation?
    12·1 answer
  • Calculate the volume of 12.0 g of helium at 100°c and 1.2 atm
    15·1 answer
  • Which of the following temperature is the coldest:
    8·2 answers
  • What is the correct name for the following compound?<br> LIAF
    10·1 answer
  • The diagram shows salt dissolved in water. What does it show about water molecules
    7·1 answer
  • In Philip’s French class, the students are learning how to pronounce closed vowels and open vowels. The students are most likely
    10·2 answers
  • Key Concepts<br> 4 Identify What are three advantages of using<br> conceptual models?<br> Help plz
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Water and a nonpolar substance will need to be forcibly mixed. this best describes a(n):__________
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!