1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lisa [10]
3 years ago
13

What does a graph representing Charles’s law show?

Chemistry
2 answers:
Lena [83]3 years ago
7 0

Volume increases at the same rate as temperature..... is the answer for sure

Juliette [100K]3 years ago
5 0
<span>Volume increases at the same rate as temperature.</span>
You might be interested in
As4S6+O2-&gt;As4O6+SO2 blanced equation
goldfiish [28.3K]
You can use the app chemical balanced it will save your life
5 0
3 years ago
A 400 ml sample of gas is heated from -20 c to 60
Viktor [21]
Using p1v1/t1=p2v2/t2
p1=50
p2=225
v1=400ml
v2=?
t1=-20=253k
t2=60=333k
50x400/253=225xv2/333
7.9=0.7xv2
v2=7.9/0.7
v2=11.3ml
6 0
3 years ago
Read 2 more answers
Please help very urgent! &lt;3
LuckyWell [14K]

Answer:

a) Neutralisation

b) Combustion

c) Synthesis

d) Decomposition

e) Neutralisation

f) Double Displacement Reaction

h) Single Displacement Reaction

i) Double Displacement Reaction

j) Combustion

Explanation:

Synthesis  is a reaction where various compounds/ elements react to form a totally new compound.

Decomposition is a reaction where a single compound breaks down into several components due to excessive heating or energy applied.

Single Displacement Reaction is a type of chemical reaction where an element reacts with a compound and takes the place of another element in that compound.

Double Displacement Reaction is a type of chemical reaction where two compounds react, and the positive ions (cation) and the negative ions (anion) of the two reactants switch places, forming two new compounds or products.

Combustion is a reaction where a compound/ element oxidises in the presence of Oxygen.

Neutralisation reaction is a reaction where an acid reacts with a base to form a salt.

5 0
3 years ago
Using the periodic table, how would you find elements with chemical properties similar to helium?
rosijanka [135]
<span>The state of the helium in its natural form is gaseous and is a chemical element of colorless aspect and belongs to the group of noble gases. The atomic number of helium is 2. The chemical symbol of helium is He. For the following we focus on those elements and relate it with similar chemical properties. Then we find that; Neon, Hydrogen, Boron and Carbon are related to helium, either by proximity in their atomic number or period or by their group.</span>
3 0
3 years ago
Which of the following does NOT play a role in South Florida’s climate?
Arlecino [84]

Answer:

i think a im not sure

Explanation:

4 0
3 years ago
Other questions:
  • How to determine the actual mass of calcium carbonate you obtained
    11·1 answer
  • A piece of glass with a mass of 32.50 g specific heat of 0.840 J/g*°C and an initial temperature of 115 °C was dropped into a ca
    8·2 answers
  • You need 1.2 moles of H2SO4 for an experiment. You weigh out 100g of this colorless syrupy liquid. Do you have enough?
    7·1 answer
  • How might you separate a mixture of sand and salt?
    9·1 answer
  • Which of the following is the best way to separate sugar from water?
    15·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Type the correct answer in the box. Express your answer to three significant figures. A balloon is filled with 0.250 mole of air
    9·1 answer
  • What is the structure of cf2br2
    7·1 answer
  • What's your favorite color ?!
    12·2 answers
  • ¿en que estado de agregacion se encuentra un cuerpo con forma y volumen propio?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!