1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Drupady [299]
2 years ago
10

As part of an investigation into the strength of electrostatic forces between molecules of water, a student will measure the mel

ting point temperature. Which part of the experimental design does this describe?(1 point)
determining the procedure
determining what data to collect
deciding on the appropriate equipment
deciding on the number of trials to perform


Which experimental design would be best to use in investigating the boiling points of water and ethanol?

Heat samples of water and ethanol in two separate beakers using a Bunsen burner. Measure the temperatures at which the samples boil using a thermometer. Record these temperatures as the boiling points.
Mix samples of water and ethanol in a beaker, then heat using a Bunsen burner. Measure the temperature at which the sample boils using a thermometer. Record this temperature as the boiling point.
Heat samples of water and ethanol in two separate beakers using a Bunsen burner. Measure the temperatures at which the samples boil using a thermometer. Conduct several trials and record the average temperatures as the boiling points.
Mix samples of water and ethanol in a beaker, then heat using a Bunsen burner. Measure the temperature at which the sample boils using a thermometer. Conduct several trials and record the average temperature as the boiling point.

Which change happens when a substance melts?(1 point)
The vibration of the molecules produces enough heat to weaken the forces of attraction between the molecules of the substance.
Heat energy overcomes the forces of attraction between the molecules of the substance, so the molecules can move more freely.
Heat energy forces the molecules of the substance farther apart until the rigid structure of the solid breaks.
The molecules of the substance move farther apart, which pulls on the intermolecular bonds between them.
Which change occurs to cause water to boil into steam?(1 point)

The addition of kinetic energy causes the motion of water molecules to overcome gravitational forces.
The addition of kinetic energy causes the motion of water molecules to overcome gravitational forces.
The removal of kinetic energy causes the motion of water molecules to overcome electrostatic forces.
The removal of thermal energy causes the motion of water molecules to overcome gravitational forces.
Chemistry
2 answers:
Gelneren [198K]2 years ago
4 0

In an experiment it is known what quantity has to measured, thus the measurement of melting point has been determining what data to collect. Thus, Option B is correct.

To investigate the boiling point of water and ethanol, the samples has to boiled at constant parameters and the data has been collected with several trials. Thus, option C is correct.

Melting has been described as the change of the solid to the liquid state. With melting, there has been heat energy higher than the force of attraction allowing the molecules to move freely. Thus, option B is correct.

The boiling has been the change in the water at liquid state to the gaseous state. With boiling there is thermal energy capable of increasing the motion of water molecules overcoming electrostatic force.

For more information about melting, refer to the link:

brainly.com/question/12499685

mel-nik [20]2 years ago
4 0

Answer:

1) B. determining what data to collect

2) C. Heat samples of water and ethanol in two separate beakers using a Bunsen burner. Measure the temperatures at which the samples boil using a thermometer. Conduct several trials and record the average temperatures as the boiling points.

3) B. Heat energy overcomes the forces of attraction between the molecules of the substance, so the molecules can move more freely.

4). The addition of thermal energy causes the motion of water molecules to overcome electrostatic forces.

Explanation:

I think these are the answers, i'll confirm when I finish the test.

You might be interested in
What is the correct name for MgF2?
maxonik [38]
MgF2 is <span>Magnesium fluoride

hope this helps!</span>
6 0
3 years ago
Read 2 more answers
How many grams in 82 moles of CO2
Tems11 [23]

44.0 g/mol

hope it helps

6 0
3 years ago
Name the following Compound: CrF2
pav-90 [236]
Chromium(II) fluoride
8 0
2 years ago
Determining nitrogen balance in the clinical setting can be very valuable. To determine a client’s state of nitrogen balance, a
nikdorinn [45]

Answer:

We also need the nitrogen intake

Explanation:

The nitrogen balance is the difference between the nitrogen intake and nitrogen excreted. If this calculation is positive, the body grow; if it is negative, the body is decreased.

6 0
2 years ago
choose any bases that will selectively deprotonate the above acid, that is, any bases that will favor the formation of products.
Zanzabum

In order to deprotonate an acid, we must remove protons in order to achieve a more stable conjugate base. For this example, we can use the relationship between carboxylic acid and hydroxide.

Deprotonation is the removal of a proton from a specific type of acid in reaction to its coming into contact with a strong base. The compound formed from this reaction is known as the conjugate base of that acid. The opposite process is also possible and is when a proton is added to a special kind of base. This is a process referred to as protonation, which forms the conjugate acid of that base.

For the example we have chosen to give, the conjugate base is the carboxylate salt. This would be the compound formed by the deprotonated carboxylic acid. The base in question was strong enough to deprotonate the acid due to the greater stability offered as a conjugated base.

To learn more visit:

brainly.com/question/5613072?referrer=searchResults

8 0
2 years ago
Other questions:
  • Please help me :(
    8·1 answer
  • The Environmental Protection Agency (EPA) and the National Highway Traffic Safety Administration (NHTSA) are coordinating standa
    7·2 answers
  • Calculate the concentration of acetate ion in a buffer solution made from 2.00 mL of 0.50 M acetic acid and 8.00 mL of 0.50 sodi
    6·1 answer
  • ryan wants to identify an element. which piece of information would best help ryan identify the element? a. how many neutrons th
    10·2 answers
  • What is the number of atoms in 3.75 mol fe
    14·1 answer
  • Why is cell uncountable? ​
    8·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • compare (a) the numer of atoms and (b) the number of grams present in 1.00 mole of helium and 1.00 mole of argon
    7·1 answer
  • Iron(III) oxide and hydrogen react to form iron and water, like this: (s)(g)(s)(g) At a certain temperature, a chemist finds tha
    14·1 answer
  • Balance the following chemical equation:<br> Mg(OH)₂ ​+ HCI → MgCI₂ ​+ H₂ ​O
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!