1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
2 years ago
7

Minerals are all naturally occurring solid substances with a definable chemical composition. They must also possess Group of ans

wer choices the ability to be synthesized in the laboratory as well as be found in nature. metallic elements, such as iron, calcium, or magnesium. metallic luster. a fixed crystalline structure (spatial arrangement of atoms and ions).
Chemistry
1 answer:
vodomira [7]2 years ago
4 0

They must also possess a fixed crystalline structure (spatial arrangement of atoms and ions).

<h3>Structure of minerals</h3>

Minerals are those naturally occurring substances that are required for proper growth of living organisms.

It is found both on earth and in food substances such as calcium, magnesium, iron.

Minerals are known to have spatial arrangement of atoms and ions. Which means the ions and atoms are not randomly arranged.

Therefore, minerals are all naturally occurring solid substances with a definable chemical composition because it possess a fixed crystalline structure.

Learn more about minerals here:

brainly.com/question/89259

You might be interested in
Starting with 2.50 mol of N2 gas (assumed to be ideal) in a cylinder at 1.00 atm and 20.0C, a chemist first heats the gas at con
arsen [322]

Answer:

a)  T_b=590.775k

b)  W_t=1.08*10^4J

d)  Q=3.778*10^4J

d)  \triangle V=4.058*10^4J

Explanation:

From the question we are told that:

Moles of N2 n=2.50

Atmospheric pressure P=100atm

Temperature t=20 \textdegree C

                      t = 20+273

                     t = 293k

Initial heat Q=1.36 * 10^4 J

a)

Generally the equation for change in temperature is mathematically given by

\triangle T=\frac{Q}{N*C_v}

  Where

  C_v=Heat\ Capacity \approx 20.76 J/mol/K

T_b-T_a=\frac{1.36 * 10^4 J}{2.5*20.76 }

T_b-293k=297.775

T_b=590.775k

b)

Generally the equation for ideal gas is mathematically given by

 PV=nRT

For v double

 T_c=2*590.775k

 T_c=1181.55k

Therefore

PV=Wbc

Wbc=(2.20)(8.314)(1181_590.778)

Wbc=10805.7J

Total Work-done W_t

W_t=Wab+Wbc

W_t=0+1.08*10^4

W_t=1.08*10^4J

c)

Generally the equation for amount of heat added is mathematically given by

Q=nC_p\triangle T

Q=2.20*2907*(1181.55-590.775)\\

Q=3.778*10^4J

d)

Generally the equation for change in internal energy of the gas is mathematically given by

\triangle V=nC_v \triangle T

\triangle V=2.20*20.76*(1181.55-293)k

\triangle V=4.058*10^4J

3 0
3 years ago
Why is not used at nuclear plant as a soverce for electrical energy
nikitadnepr [17]
The biggest reason is radioactive wastes. Nuclear power generated radioactive wastes like Uranimum, plutonium and amercium that inhibits gene expression and causes cancer to the environment. Nuclear plants use to release these wastes into the oceans, and it causes fishes to exhibit gender change, 3 eyes, 2 tails etc. The impact on human shows signs of serious blood, liver and lung cancers. 

There are currently no way to get rid of these wastes as they take hundred thousands of years to decompose. 

Another reason is they cause a small amount of green gas emission. Releases CO2 to the sky. They exhibit radioactive gas emission as well (causes cancer) .
7 0
3 years ago
Is silver a compund or mixture
Rasek [7]
Silver is not a compound. It's a mixture
5 0
3 years ago
According to the law of conservation of mass, if five atoms of hydrogen are used
Blababa [14]

Answer:

it would be 07

mark  brainlyest

4 0
2 years ago
What volume of 0.585 m ca(oh)2 would be needed to neutralize 15.8 l of 1.51 m hcl?
SpyIntel [72]
When the balanced reaction equation is:

2HCl(aq) + Ca(OH)2(aq) → CaCl2(aq) + 2H2O(l)

from the balanced equation, we can get the molar ratio between HCl & Ca(OH)2

2:1

∴ the volume of Ca(OH)2 = 15.8 L HCl * 1.51 m HCl * (1mol Ca(OH)2/ 2mol HCl) *                                           (1L ca(OH)2/0.585 mol Ca(OH)2 

                                          = 20.4 L
8 0
3 years ago
Other questions:
  • I NEED HELP FAST!
    9·1 answer
  • Engineers increase output in crop production by combining the strengths of
    6·1 answer
  • Type the correct answer in the box.
    5·1 answer
  • Which of these statements supports the idea that digital recording of audio is more reliable than analog recording?
    5·1 answer
  • C-12 and C-13 are naturally-occurring isotopes of the element carbon. C-12 occurs 98.88% of the time and C-13 occurs 1.108% of t
    8·1 answer
  • Identify the balanced chemical equation that represents a single displacement reaction. CF4 2Br2 ⟶ CBr4 2F2 3H2SO4 2Al ⟶ Al2(SO4
    5·1 answer
  • Mixture of acid and base
    11·1 answer
  • The solubility of CaSO4 in pure water at 0oC is 1.09 gram(s) per liter. The value of the solubility product is g
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Which of the following represents a neutralization reaction which hydrofluoric acid and sodium hydroxide(a base) react to produc
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!