I would say it is answer choice C, Laws are based on proven hypothesis by many different scientists.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
True. For example, electron domain geometry and molecular geometry of water and ammonia are different.
Answer:
The unknown solution had the higher concentration.
Explanation:
When two solutions are separated by a semi-permeable membrane, depending on the concentration gradient between the two solutions, there is a tendency for water molecules to move across the semi-permeable in order to establish an equilibrium concentration between the two solutions. This movement of water molecules across a semi-permeable membrane in response to a concentration gradient is known as osmosis. In osmosis, water molecules moves from a region of lower solute concentration or higher water molecules concentration to a region of higher solute concentration or lower water molecules concentration until equilibrium concentration is attained.
Based on the observation that when the glucose solution described in part A is connected to an unknown solution via a semipermeable membrane, the unknown solution level rises, it means that water molecules have passed from the glucose solution through the semipermeable membrane into the unknown solution. Therefore, the solution has a higher solute concentration than the glucose solution.
Answer:
Both
compounds in left hand side of the equation is called reactants.
compounds in right hand side of the equation is called products.
so ans is both water and carbon di oxide
Explanation:
