I just took that quiz , it’s A
The common substance among the product(s) of the first equation and among the reactant(s) in the second equation is H2O(g). We can eliminate that as an intermediate. The overall chemical equation will thus be:
CH4(g) + 2O2(g) → CO2(g) + 2H2O(l),
which is the first answer choice.
In essence, all you’re doing here is swapping water vapor for liquid water.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
Wetlands are important features in the landscape that provide numerous beneficial services for people and for fish and wildlife. Some of these services, or functions, include protecting and improving water quality, providing fish and wildlife habitats, storing floodwaters and maintaining surface water flow during dry periods. These valuable functions are the result of the unique natural characteristics of wetlands.
Answer: Vibråtory movement.
Explanation: when particles bounce against each other the friction creates thermal energy. Think about what happens when you rub your hands together and they get warmer, that the friction between your hands making thermal energy.