1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
2 years ago
12

Explain why the amino group of p-aminobenzoic acid does not participate in the reaction

Chemistry
1 answer:
lubasha [3.4K]2 years ago
5 0

This is because amino group of p-aminobenzoic acid is an aniline and is less electrophilic than an alkyl amine.

<h3>What is an Aniline?</h3>

This is an aromatic amine which consists of a phenyl group attached to an amino group.

The amino group of p-aminobenzoic acid being an aniline makes it less electrophilic which is why an alkyl amine participates in the reaction instead.

Read more about Aniline here brainly.com/question/9982058

You might be interested in
½H2(g) + ½I2(g) → HI(g), ΔH = +6.2 kcal/mole 21.0 kcal/mole + C(s) + 2S(s) → CS2(l) What type of reaction is represented by the
wlad13 [49]

<u>Answer:</u>

Exothermic Reaction are those reaction, in which energy is released while in endothermic reaction are those, in which energy is absorbed.

<u>Explanation:</u>

First Reaction:

As in this reaction, energy is released

½H2(g) + ½I2(g) → HI(g), ΔH = +6.2 kcal/mole

so it is <em>exothermic reaction</em>

Second reaction:

As in this reaction, energy is absorbed

21.0 kcal/mole + C(s) + 2S(s) → CS2(l)

so it is <em>endothermic reactions</em>.


7 0
4 years ago
Read 2 more answers
Why do atoms bond????????
Doss [256]
<span> In order to create a complete full outer shell of electrons.
</span><span /><span>
</span>
4 0
3 years ago
Read 2 more answers
Question 8 (10 points)
I am Lyosha [343]

Answer:

positively charged elctrons

4 0
3 years ago
Read 2 more answers
A rock dropped Into a glass of water ralses the water level
asambeis [7]

Answer:

You can infert that it has a mass of 40 grams.It also has desnity of 40 grams per millilieter.

Explanation:

7 0
3 years ago
Water flows over Niagara Falls at the average rate of 2,400,000 kg/s, and the average height of the falls is about 50 m. Knowing
Andre45 [30]

Answer:

Power, P=1.176\times 10^9\ W

No of bulbs = 78400000

Explanation:

We have,

Water flows over Niagara Falls at the average rate of 2,400,000 kg/s, it mean it is mass per unit time i.e. m/t.

It falls from a height of 50 m

The gravitational potential energy of falling water is given by :

P = mgh

Power is equal to the work done divided by time taken. So,

P=\dfrac{W}{t}\\\\P=\dfrac{mgh}{t}\\\\P=\dfrac{m}{t}\times gh

So,

P=2400000\times 9.8\times 50\\\\P=1.176\times 10^9\ W

Let there are n bulbs that could power 15 W LED. It can be calculated by dividing the power by 15. So,

n=\dfrac{1.176\times 10^9}{15}\\\\n=78400000\ \text{bulbs}

It means that the number of bulbs are 78400000.

3 0
3 years ago
Other questions:
  • Calcium carbonates are incorporated into the shells of microscopic marine plants and animals and then participate into the ocean
    11·1 answer
  • A solution was prepared by dissolving 0.800 g of sulfur S8, in 100.0 g of acetic acid, HC2H3O2. Calculate the freezing point and
    12·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • List three factors that can affect gas pressure
    14·1 answer
  • How might orange frogs change because of the red fly
    9·1 answer
  • n the laboratory, two forms of sodium phosphate will be available (the monobasic monohydrate NaH2PO4·H2O, F.W. = 137.99 g/mol, a
    8·1 answer
  • How many atoms and ions does nickel oxide have?
    14·1 answer
  • Convert 3.9x10^5mg to dg
    9·2 answers
  • Mengapa air panas maupun air dingin yang disimpan di dalam termos cenderung lebih tahan lama suhu panas atau dinginnya
    11·1 answer
  • Calculate the quantity of electricity obtained from 2 moles of electrons​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!