1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RUDIKE [14]
2 years ago
9

The fuel used to power the booster rockets on space shuttles is a mixture of aluminum metal and ammonium perchlorate. the follow

ing balanced equation represents the reaction.. 3al 3nh4clo4 → al2o3 alcl3 3no 6h2o how many moles of water are produced from 373 mol al?
Chemistry
1 answer:
Charra [1.4K]2 years ago
6 0

The moles of water that are produced from 373 moles of ammonia present in any chemical reaction is 746 moles.

<h3>What is the stoichiometry?</h3>

Stoichiometry of the reaction gives idea about the amount of entities present in any chemical reaction before and after the reaction.

Given chemical reaction is:

3Al + 3NH₄ClO₄ → Al₂O₃ + AlCl₃ + 3NO + 6H₂O

From the stoichiometry of the reaction it is clear that:

3 moles of Al = produces 6 moles of H₂O

373 moles of Al = produces 6/3×373 = 746 moles of H₂O

Hence required moles of water is 746 moles.

To know more about stoichiometry, visit the below link:

brainly.com/question/21931988

                                                                                                                                                                                                                                                                                                                               

You might be interested in
Help me please!
Bumek [7]
Good luck kid, now mark me brainliest
8 0
3 years ago
Concentrated hydrochloric acid is an aqueous solution that is 34.70 % HCl. The density of the solution is 1.19 g/mL. What mass o
mixas84 [53]

The mass of HCl that is contained in the solution is 147 g HCl

Why?

To find the mass of HCl we have to apply what is called a conversion factor. In a conversion factor we put the units we don't want at the bottom, and the ones we want at the top.

For this question, we want to go from liters of solution to mass of HCl, and the conversion factor is laid out as follows:

0.356Lsolution*\frac{1000mL}{1L}*\frac{1.19 g solution}{1 mL solution}*\frac{34.70 g HCl}{100 g solution}=147 g HCl

Have a nice day!

#LearnwithBrainly

3 0
3 years ago
58.0 g of K2SO4 was dissolved in 500 g of water. What is the molality of this solution?
podryga [215]

Answer: The molality of solution is 0.66 mole/kg

Explanation:

Molality of a solution is defined as the number of moles of solute dissolved per kg of the solvent.

Molarity=\frac{n\times 1000}{W_s}

where,

n = moles of solute

W_s = weight of solvent in g

moles of K_2SO_4 = \frac{\text {given mass}}{\text {Molar Mass}}=\frac{58.0g}{174g/mol}=0.33mol

Now put all the given values in the formula of molality, we get

Molality=\frac{0.33\times 1000}{500g}=0.66mole/kg

Therefore, the molality of solution is 0.66 mole/kg

7 0
3 years ago
Is the earths crust brittle? Why is this? Do the earthquakes occur in the crust? Heellp
ale4655 [162]
The rocky outer layer of Earth's<span> surface. The two types of </span>crust<span> are continental and oceanic. The layer of solid, </span>brittle<span> rock that makes up the </span>Earth's<span> surface. The lithosphere is composed of the </span>crust<span> and the uppermost mantle</span>
4 0
3 years ago
When a piece of metal is irradiated with UV radiation (λ = 162 nm), electrons are ejected with a kinetic energy of 3.54×10-19 J.
dsp73

We have that the work function of the metal

\phi=1.227*10^{-18}J

From the Question we are told that

UV radiation (λ = 162 nm)

Kinetic energy K.E =3.54*10-19 J.

Generally the equation for Kinetic energy    is mathematically given as

KE =\frac{hc}{\pi-\phi} \\\\\phi =\frac{ 6.626*10^{-34} * 3*10^8}{162*10^{-9} -3.54*10^{-19}}

\phi=1.227*10^{-18}J

For more information on this visit

brainly.com/question/12669551?referrer=searchResults

8 0
3 years ago
Other questions:
  • At what temperature will water freeze if 100g NaCl are dissolved in 500g H2O?
    7·1 answer
  • What happens to carbon when a candle burns
    9·1 answer
  • How many grams are in 2.30 x 10^24 atoms in silver
    10·1 answer
  • Hakim used 18000J of energy to climb up to the top of a building in 10 mins. calculate the power he developed in climbing up to
    10·1 answer
  • How many molecules of NaCl are in 58.5 g NaCl?
    11·1 answer
  • A single atom of calcium could combine with a single atom of fluorine, creating electron energy stability for both atoms. True F
    13·1 answer
  • Pls help I’m about to cry I cant do this it’s due in ten min
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • The percent ionization of a 0.350 M HC,H,O2 solution. Ka(HC2H302)​
    9·1 answer
  • Which of the following ions would be expected to
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!