The third one, it releases H+ions into a solution.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
A
Explanation:
Molecules of a gas are relatively more compressible than those of liquids and solids because they are relatively far apart without any intermolecular forces between them. However, at lower temperature and higher pressure, there is now a significant intermolecular interaction between the gas molecules and they are no longer relatively far apart. Hence they are more compressible than liquids and solids which already possess significant intermolecular interaction and thus a definite volume.
Answer:
Option C
Explanation:
The answer to this question will be the third option "It is bendable." Malleable means to be able to change the shape of a object without damaging or breaking it. In this case a malleable solid would be for example drainage pipes. These pipes have curves and different shapes but still remain its product of a metal.
Hope this helps!
