1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
2 years ago
14

Besides drinking water, how is water helpful for life and nature?

Chemistry
1 answer:
Contact [7]2 years ago
5 0

Answer:

It keeps us alive, helps us grow plants, helps plants thrive, gives us food, helps keep our animals and crops healthy, cleans us, and so much more

Explanation:

You might be interested in
Can one mole of peas fit inside your house? List the materials and steps of an experiment that answers the
svlad2 [7]

Answer:

No.

Explanation:

No, one mole of peas do not fit inside a house because one mole is equals to 6.022 × 10²³ units which is a very large value. mole only use for atoms, ions and molecules etc due to very small size but mole is not used for big sized materials such as peas and other vegetables etc. So that's why we can conclude that one mole of peas did not fit inside a house.

6 0
3 years ago
Force develops when two solutions each different concentration solutes separated semipermeable membrane
Zarrin [17]
Answer is: osmotic pressure.
Osmotic pressure, alongside the vapor pressure depression, freezing point depression and the boiling point elevation are<span> the </span>colligative properties od solution.
<span>The direction of osmotic pressure is always from the side with the lower concentration (c = n/V) of solute to the side with the higher concentration.</span>
3 0
3 years ago
What is the hydroxide ion concentration in a water solution that has a hydronium ion concentration of 5.36*10-8 M?
Tanzania [10]

Answer:

that I have a panda but the black on it and I have a panda but the black on it and I have a panda but the black on it and I have no clue u

8 0
3 years ago
Which six elements are generally considered metalloids
chubhunter [2.5K]

Answer:

boron, silicon, germanium, arsenic, antimony, and tellurium

4 0
3 years ago
Read 2 more answers
When a strontium atom loses two electrons to form an Sr2+ ion, the electrons are lost from the
kherson [118]

Answer:When a strontium atom loses two electrons, it becomes a(n) cation with a charge of 2+. when any neutral atom loses an electron it becomes cation that is positively charged ions and an ion gets the charge according to the number of electrons loses.

you are very welcome but I may be inaccurate.

6 0
3 years ago
Other questions:
  • During steps 2-5, the
    6·2 answers
  • What happens as you increase the temperature of a reaction?
    13·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 1. SEP Develop Models Develop a model to show the chemical potential energy of
    5·1 answer
  • Question 5(Multiple Choice Worth 3 points)
    15·1 answer
  • How are the aurora borealis formed?
    5·1 answer
  • Number 7 plssssssssssss
    15·2 answers
  • Which element has 13 protons and 8 neutrons?
    8·2 answers
  • How many valence electrons does an atom of Iodine have?<br><br> a) 5 <br> b) 6 <br> c) 7 <br> d) 8
    6·2 answers
  • How many grams of oxygen gas occupy 12.3 L of space at 109.4 kPa and 15.4oC?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!