1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
1 year ago
15

18. Which hydrocarbon has more than one possible

Chemistry
1 answer:
emmainna [20.7K]1 year ago
7 0

See here question has answer in itself

The structural isomerism starts always from but word root .

So butane has one and most among all as rest three have none .

The two isomers are

  • n-butane
  • iso-butane
You might be interested in
PLS ANSWER FAST AHAH<br><br> distilled water is a pure substance <br> true or false ?
mr Goodwill [35]

Answer:

True

Explanation:

If you see distilled water, it's a pure substance. That means that there are only water molecules in the liquid. A mixture would be a glass of water with other things dissolved inside, like one of those powders you take if you get sick or Kool-Aid.

3 0
3 years ago
What information does the atominic numer give you about an element
uysha [10]

Answer:

It gives the number of protons in the nucleus of each atom of that element.

Explanation:

6 0
2 years ago
What do the coefficients located before certain molecules in each chemical equation represent?
olga55 [171]
It represents the number of moles required of that molecule to balance the chemical equation, which means to have the reaction chemically happen and goes to completion.

For example:
CH4 + O2 --> H2O + CO2     that is not balanced

with the coefficients located
CH4 + 2O2 --> 2H2O + CO2    now with the coefficients the number of oxygen and hydrogen on each side are equal
6 0
3 years ago
Complete the sentence.
Leno4ka [110]

Answer:

6, double

Explanation:

Hex- is a prefix for number 6.

Ene- is a suffix for a double bond.

7 0
2 years ago
Can someone please help with this-
Nonamiya [84]
Ignition wires make it more accurate because it will cook it faster
stirrer would have the less results of fast
a sealed bomb may cook it fast but you would have to be careful and don't mess up
5 0
3 years ago
Other questions:
  • When glass is formed, which of these takes place FIRST?
    9·2 answers
  • The prefix centi- means (2 points) Select one: a. 103 b. 10-2 c. 10-3 d. 102
    13·1 answer
  • What is normal body temperature in degrees celsius? express your answer numerically in degrees celsius?
    6·1 answer
  • Chlorine + potassium bromide <br> What is the equation for this??
    14·1 answer
  • When Mrs. Green describes the physical properties of matter she said that physical properties often concern changes in state. On
    5·1 answer
  • Which of the following molecules is a polymer of a smaller carbohydrate unit?a. lactaseb. glucosec. glycogend. sucrosee. triacyl
    5·1 answer
  • When paper is burned, the mass of the remaining ash is less than the mass of the original paper.
    6·1 answer
  • What is the pH of a solution that contains a pOH of 7.9?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Un recipiente cerrado, de 4,25 L, con tapa móvil, contiene H2S(g) a 740 Torr y 50,0°C. Se introduce en ese recipiente N2(g) a te
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!