1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
snow_lady [41]
1 year ago
6

How does the maximum oxidation number vary across a period in the main groups? Is the pattern in Period 2 different?

Chemistry
1 answer:
snow_lady [41]1 year ago
5 0

As a result, the greatest number of an atom's oxidation state will gradually rise over each period of the periodic table. For instance, the third period's highest value of the oxidation number will fall between 1 and 7.

  • The Periodic Table only consistently varies the oxidation numbers of Group 1 and Group 2 metals in their compounds, which are always +1 and +2, respectively.
  • Elements have an increasing number of valence electrons that can range from 1 to 8 and move from left to right over time. However, when H or O are added to an element first, the element's valency rises to 4, then falls to zero.
<h3>What causes a rise in the oxidation number?</h3>

An increase in oxidation number results from the loss of negatively charged electrons, whereas a reduction in oxidation number results from the gain of electrons. The result is a rise in the oxidation number of the oxidized element or ion.

<h3>Pattern of the Period 2?</h3>

The trends in Period 2 are significantly more clear-cut. All elements in period 2 experience a decrease in atomic radius, an increase in electronegativity, and an increase in ionization energy as their atomic number rises.

To know more about Periodic table please click here : brainly.com/question/15987580

#SPJ4

You might be interested in
How many moles are there in 3.612 x 1024 molecules of CaO?
melamori03 [73]

The number of moles in  3.612 x 10²⁴ molecules of CaO is  6 moles.

<h3>Number of moles in the molecules</h3>

The number of moles in  3.612 x 10²⁴ molecules of CaO is calculated as follows;

6.02 x 10²³ molecules = 1 mole

3.612 x 10²⁴ molecules = ?

= (3.612 x 10²⁴ ) / (6.02 x 10²³ )

= 6 moles

Thus, the number of moles in  3.612 x 10²⁴ molecules of CaO is  6 moles.

Learn more about number of moles here: brainly.com/question/15356425

3 0
2 years ago
What is the term for the number of protons in the nucleus of each atom of an element?
xxTIMURxx [149]

Answer:

atomic number

Explanation:

atomic number is the number of protons

5 0
1 year ago
Calculate the pOH of a 0.0143 M NaOH solution at 25 ⁰C.
arsen [322]

Answer:

A.) 1.845

Explanation:

You can find the pOH using the following equation:

pOH = -log[OH⁻]

Since NaOH dissociates into 1 Na⁺ and 1 OH⁻, the concentration of both ions is 0.0143 M.

pOH = -log[OH⁻]

pOH = -log[0.0143]

pOH = 1.845

5 0
2 years ago
Why aren't descriptive investigations repeatable?
Bad White [126]
In descriptive investigations, we still haven't formed any hypothesis yet so we seek information by asking question.

It's not repeatable because repeating the questions over and over again without any clue about what we want to seek is completely waste of time.

Hope this helps xox :)
8 0
3 years ago
Read 2 more answers
Why does magma in the mantle rise through the crust above it
Natali5045456 [20]
Currents from the lava
4 0
3 years ago
Read 2 more answers
Other questions:
  • what is molarity of a sodium hydroxide solution made by combining 2.0 L of 0.60 M NaOH with 495 mL of 3.0 M NaOH? Assume the vol
    5·1 answer
  • How are fossil fuels used in the harvesting of fresh apples from an apple tree?
    15·2 answers
  • Put this in scientific notation. 10 m to centimeters and 37.5 g/mL to kg/L
    15·2 answers
  • Use the drop-down menus to complete each sentence.
    13·2 answers
  • 4. Describe in detail the relationship between chemical bonds and energy. What must be true of the bonds for a reaction to be en
    9·1 answer
  • What is the change in atomic mass when an atom emits an alpha particle? A. decreases by 2 B. decreases by 1 C. decreases by 4 D.
    6·1 answer
  • A metallic conductor moving at a constant speed in a magnetic field may develop a voltage across it. this is an example of _____
    14·1 answer
  • A civil engineer chooses to use wooden beams because they will sag before
    14·2 answers
  • For the following word equations, write it as a chemical equation, then balance it.
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!