Explain how earth plates and lithosphere are related

1 answer:

6 0

Crust, the upper layer of the Earth, is not always the same. Crust under the oceans is only about 5 km thick while continental crust can be up to 65 km thick. Also, ocean crust is made of denser minerals than continental crust.

The tectonic plates are made up of Earth’s crust and the upper part of the mantle layer underneath. Together the crust and upper mantle are called the lithosphere and they extend about 80 km deep. The lithosphere is broken into giant plates that fit around the globe like puzzle pieces. These puzzle pieces move a little bit each year as they slide on top of a somewhat fluid part of the mantle called the asthenosphere. All this moving rock can cause earthquakes.

The asthenosphere is ductile and can be pushed and deformed like silly putty in response to the warmth of the Earth. These rocks actually flow, moving in response to the stresses placed upon them by the churning motions of the deep interior of the Earth. The flowing asthenosphere carries the lithosphere of the Earth, including the continents, on its back.

You might be interested in

Which phrase describes a characteristic of an Arrhenius base?

Tom [10]

The phrase that describes a characteristic of an Arrhenius base is that Arrhenius base add hydroxide ions to the solution ( answer C)

<u><em>Explanation</em></u>

Arrhenius base is a substance that increases the concentration of OH- in aqueous solution.

The Common Arrhenius base are group 1 and 2 hydroxide such as LiOH, NaOH , Ba(OH)2 among others.

for example NaOH dissociate as follows , NaOH → Na+(aq) + OH- (aq)

6 0

3 years ago

Read 2 more answers

If 54 g of Al reacted with 160 g of O2, find out the weight of product

Oxana [17]

Answer:

number of Al atom =54÷27=2atom of Al. number of o atom = 160÷16=10 atom of o . =214U MASS of ALO2.

4 0

3 years ago

Look at the electron-dot diagram. What type of bond would two sulfur atoms require to form a molecule?

Blababa [14]

Answer:

Double Covalent

Explanation:

When two of the same element combine it will always be a covalent bond between them and since sulfur has two lone electrons it will make a double bond between the two to have a full octect

4 0

3 years ago

Which of the following is the best way to separate sugar from water?

kompoz [17]

I don't know the options but usually a small strainer or a coffee thing u put over a cup and let the water seep down and the sugar stays.

4 0

3 years ago

Read 2 more answers

DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte

uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0

3 years ago