Answer: 3.01 x 10^24 atoms
Explanation:
Based on Avogadro's law:
1 mole of any substance has 6.02 x 10^23 atoms
So, 1 mole of water = 6.02 x 10^23 atoms
5 moles of water = Z atoms
To get the value of Z, cross multiply
Z x 1 mole = (6.02 x 10^23 atoms x 5 moles)
Z•mole = 30.1 x 10^23 atoms•mole
Divide both sides by 1 mole
Z•mole/1 mole = 30.1 x 10^23 atoms•mole/ 1 mole
Z = 30.1 x 10^23 atoms
[Place the value of Z in standard form]
Z = 3.01 x 10^24 atoms
Thus, there are 3.01 x 10^24 atoms in 5 mole of water
You just need to multiply the total mass by the decimal value of the part that is tin. 133.8*0.103=13.8g (following the rules of significant figures).
Answer:
Hey there!
Auto-ionization of water is an ionization reaction in pure water or in another aqueous solution, in which a water molecule, H2O, loses the nucleus of one of its hydrogen atoms to become a hydroxide ion, OH−.
Let me know if this helps :)
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
LMBO, for science.
Answer:
<em>The increase in kinetic energy leads to leakage of water from the syringe. When the outside temperature is more than the liquid temperature, say the syringe is out in sunshine, then the liquid becomes slightly warmer.</em>
