1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
5

Which is an example of a mixture?

Chemistry
2 answers:
BabaBlast [244]3 years ago
7 0
B. trail mix
because you can easily take all the peaces out unlike water you cant physically take the oxygen out
yKpoI14uk [10]3 years ago
6 0

Answer:

B trail mix

Explanation:

Everything else is one lol trail mix is trail MIX

You might be interested in
Sodium metal and water react to create sodium hydrogen and hydrogen gas through the unbalanced equation.
Maurinko [17]

Answer:

Theoretical yield = 2.5 g

Explanation:

Given data:

Mass of sodium = 79.7 g

Mass of water = 45.3 g

Theoretical yield of hydrogen gas = ?

Solution:

Chemical equation:

2Na + 2H₂O → 2NaOH + H₂

Number of moles of sodium:

Number of moles = mass/ molar mass

Number of moles = 79.7 g / 23 g/mol

Number of moles = 3.5 mol

Number of moles of water:

Number of moles = mass/ molar mass

Number of moles = 45.3 g / 18g/mol

Number of moles = 2.5 mol

Now we will compare the moles of hydrogen gas with water and sodium.

                        H₂O           :             H₂

                           2             :              1

                          2.5           :            1/2×2.5 =1.25 mol

                     

                           Na           :              H₂

                             2            :               1

                           3.5           :             1/2×3.5 =1.75 mol

water will be limiting reactant.

Theoretical yield:

Mass = number of moles × molar mass

Mass =  1.25 mol  × 2 g/mol

Mass = 2.5 g

8 0
3 years ago
In which process are simple materials chemically combined to form more complex materials?
allsm [11]

Answer:

A) synthesis

I hope this helps!

3 0
3 years ago
Select all the correct images<br><br> Select the atoms that belong to the same element
mezya [45]

Answer: Atoms with 11 protons, 10 neutrons and 11 electrons belong to the same element with 11 protons, 12 neutrons and 11 electrons.

Explanation:

Elements that contain same number of valence electrons belong to the same group. This is because they will have same reactivity (or properties) due to which they lie in the same group.

For example, element with 11 protons, 10 neutrons and 11 electrons is same as the element with 11 protons, 12 neutrons and 11 electrons.

Hence, both these atoms belong to the same element.

Thus, we can conclude that atoms with 11 protons, 10 neutrons and 11 electrons belong to the same element with 11 protons, 12 neutrons and 11 electrons.

3 0
3 years ago
Acetone, CH3COCH3, is a nonelectrolyte; hypochlorous acid, HClO, is a weak electrolyte; and ammonium chloride, NH4Cl, is a stron
Licemer1 [7]
So the question ask on what solute are present in an aqueous solution on a certain element base on the data you have given. So base on that data i came up with a chemical expression of HCIO, H+ and CIO-. I hope you are satisfied with my answer 
4 0
4 years ago
Read 2 more answers
Explain how atoms are held together in covalent bonds. Give an example of a covalent compound.
asambeis [7]

Answer:

Explanation:

Atoms are held together by covalent bonds when they share electrons between themselves.

Covalent bonds are bonds that are formed between non-metals usually with a low electronegative difference between them. In this bond type, two non-metals donate electrons which are shared between the combining atoms and this makes them both like the corresponding noble gases. The shared electrons is what forms the covalent bonds.

An example of covalent bond is HCl, H₂S, SO₂, CO₂, O₂ etc

5 0
3 years ago
Other questions:
  • Billy decides to test the factors that affect plant growth. He uses sunflowers, daisies, and bean plants. He gives some of the p
    7·1 answer
  • What happens to the individual molecules of a liquid as they gain enough kinetic energy to escape the surface of the liquid?
    14·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • • When one organism eats another organism, what % of the energy from the organism consumed is actually available to the consumer
    7·1 answer
  • What is the percent yield for a reaction if the theoretical yield of Fe2(SO4) is 33.14 g and the
    13·1 answer
  • Part a use valence bond theory to devise a hybridization and bonding scheme for co2. match the words in the left column to the a
    15·1 answer
  • Predict the number of each atom needed to form a molecule of potassium Sulfide.
    13·1 answer
  • HELP ASAP PLEASE I'LL GIVE BRAINLIEST
    10·2 answers
  • Draw the structure of the major organic product(s) for the following reaction between an acetylenic anion and an alkyl halide. (
    9·1 answer
  • at 530.4 mmhg and 55.3oc, a 3.14-l sample of a hydrocarbon gas has a mass of 2.28 g. what is the formula of the gas?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!