1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvv77 [185]
3 years ago
5

All mixtures can be separated by physical processes. true or false

Chemistry
1 answer:
DaniilM [7]3 years ago
7 0
<span>True. In chemistry, mixtures are two (or more) substances mixed together but not combined chemically. This means there are no chemical bonds that have formed between the substances. As such, they can be separated with physical processes.</span>
You might be interested in
Fatima is designing an advanced graphics card for a next-generation video game system. She needs to be able to
Bad White [126]

Answer:

semiconducting,tellurium

Explanation:

just completed the assignment

4 0
3 years ago
Read 2 more answers
Why is ginger used in food preservation
Vaselesa [24]
Spices like ginger are significantly used in preservatives because they have antimicrobial properties in their chemical compounds. They also have antioxidant properties that allow food to be preserved.
6 0
3 years ago
Help I’ll give Brainliest
olasank [31]

Answer:

D

Explanation:

ive watched this on a national geo show. But remind me again what is 1 Au and 3DO AU i forgot...

4 0
3 years ago
Write empirical formula
andrew11 [14]

Answer:

Pb(ClO_{3})_{4}\\Pb(MnO_{4})_{4}\\Fe(ClO_{3})_{3}\\\Fe(MnO_{4})_{3}\\

Explanation:

Pb^{4+}(ClO_{3}^{-})_{4}--->Pb(ClO_{3})_{4}\\Pb^{4+}(MnO_{4}^{-})_{4}--->Pb(MnO_{4})_{4}\\Fe^{3+}(ClO_{3}^{-})_{3}--->Fe(ClO_{3})_{3}\\\Fe^{3+}(MnO_{4}^{-})_{3}--->Fe(MnO_{4})_{3}\\

3 0
3 years ago
What are some uses of metals?
VashaNatasha [74]
They are used to make plane bodies.
Some are used for electrical wires eg copper because they are good conductors of electricity.
Used in building materials.
used to make jewelry eg gold and silver<span />
4 0
3 years ago
Read 2 more answers
Other questions:
  • Ionic formula for ethanoate ion
    10·1 answer
  • You notice that the water in your friend's swimming pool is cloudy and that the pool walls are discolored at the water line. A q
    15·1 answer
  • True or False.
    9·2 answers
  • What is the natural rate of nitrogen fixation in Earth’s ecosystems? What is the natural rate of nitrogen fixation in Earth’s ec
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which best describes the effect of J. J. Thomson’s discovery?
    13·1 answer
  • Which of the following best describes a chemical mixture​
    12·1 answer
  • HELPPPPP MMMMEEEEEEEE
    10·2 answers
  • 15.
    5·1 answer
  • What is Heat? What is Cold?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!