1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
3 years ago
10

Which of the following cannot be tested by science?

Chemistry
2 answers:
kifflom [539]3 years ago
7 0
How emotions affects the quality of paints
Digiron [165]3 years ago
4 0
B. how emotions affects the quality of a painting
You might be interested in
Used to measure temperature in 8th grade science.
zvonat [6]

Answer:

Fahrenheit

Explanation:

4 0
3 years ago
How is it that when a salt sample dissolves in water, the delta S for the process is positive?
Bess [88]

Answer:-

Water is highly ordered. In water each oxygen atom is connected to others around it through hydrogen bonding via bridging hydrogen atoms. When a salt like NaCl is dissolved, some of these Hydrogen bonds break.

When a salt like NaCl dissolves in water, the NaCl breaks in to ions Na+ and Cl-.

The water molecules now surround these ions.

The slightly negative oxygen end of water molecule gets near the Na+, while the slightly positive Hydrogen of water molecule gets near the Cl-.

So before salt sample dissolve, the water molecules were highly ordered due to hydrogen bonding. Now after salt dissolve there is a decrease in order and thus an increase in disorder of the water molecules.

Due to increase in disorder, entropy which is a measure of disorder increases. Since entropy increases, delta S for the process is positive.

4 0
3 years ago
Please help will give 30 points.
vredina [299]

Answer:

Dependent variable: If calcium is given, then bone strength will increase.

Explanation:

3 0
3 years ago
What is the correct way to smell a chemical
exis [7]

Answer:

If you need to smell the odor of a chemical, waft or fan the fumes toward your nose with one hand. Do not put your nose over the container and inhale the fumes.

Do not touch, eat, or smell any chemical unless instructed to do so. ... Hold chemical containers away from your body. Carefully check the label on the bottle before using its content.

8 0
3 years ago
Read 2 more answers
The state of matter that is able to be compressed is <br><br> gas <br><br> liquid <br><br> solid
Anarel [89]
Gases are easily compressible

8 0
4 years ago
Read 2 more answers
Other questions:
  • All of the atoms of argon have the same?
    13·2 answers
  • What element has beryl emeralds and aquamarine?
    10·1 answer
  • If an athlete weighs 147 lb and has 15.0 % body fat by weight, how many pounds of fat does the athlete's body contain?
    15·1 answer
  • Explain why a fluorescent light bulb is not as hot as an incandescent light bulb.
    13·2 answers
  • What is the theoretical yield of ammonia that can be obtained from the reaction of 10.0 g of H2 and excess N2?
    6·1 answer
  • What characteristics separate the class Insecta from other classes of the phylum Arachnida
    6·1 answer
  • 7.62 x 10^23 molecules of CO2 are contained in a tire. How large is the tire (in liters)?​
    7·1 answer
  • What would be the anode<br> a magnesium and zinc galvanic cell?
    9·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Can someone help me with this
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!