1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
3 years ago
15

How many hydrogen atoms are in a cycloalkane with 8 carbon atoms?

Chemistry
1 answer:
frosja888 [35]3 years ago
8 0
Cycloalkanes are those saturated organic compounds which exist in the form of Rings. Their Hydrogen Deficiency Index in one. The General formula for cycloalkanes is,
                                                  CnH2n
When number of Carbons = 8
Then
                                                  C₈H₂₍₈₎

                                                  C₈H₁₆

Result:
           
Cycloalkane containing 8 carbon atoms has 16 hydrogen atoms.

You might be interested in
7. Complete the concept map below.
Ilya [14]

Drainage that is not handled properly can cause an increase in erosion, changes in stormwater runoff, flooding, and damage to water quality.

<h3>Natural Disaster?</h3>
  • Large-scale geological or meteorological phenomena that have the potential to cause loss of life or property are considered natural disasters.
  • Tornadoes and severe storms are examples of these catastrophes. Tropical Storms and Hurricanes. Floods.
  • They release significant amounts of gas and dust into the atmosphere, particularly the upper atmosphere, which temporarily alters the climate on Earth.
  • Large volcanic eruptions should be followed by a drop in the average surface temperature, which is actually seen and lasts for typically 1 to 3 years.
  • Deforestation and the combustion of fossil fuels have detrimental environmental effects that directly affect the biosphere. Pollutant emissions and carbon dioxide have a negative impact on all types of life.

To learn more  about Natural Disaster refer to:

brainly.com/question/13800641

#SPJ13

4 0
1 year ago
What is absolute zero? A) The temperature at which the particles of matter are at their lowest energy points. B) The temperature
Alja [10]

Answer:

A) The temperature at which the particles of matter are at their lowest energy points.

Explanation:

Absolute temperature refers to the lowest  possible temperature. At this state,  no heat energy remains in the substance; the energy of the particles are at their lowest energy points.

7 0
3 years ago
What are the respective hybridizations of the imine nitrogen and carbonyl carbon of the CPV B-state as it is depicted in the pas
horsena [70]

Answer:

C) sp2 and sp2

Explanation:

The hybridization depens on the ammount and type of bonds the atom analized has in the molecule.

For example:

  • A C atom bonded to 4 H atoms has a sp3 hybridization.
  • A C atom bonded to 2 H atoms and to 1 C with a double bond (like in ethene) has a sp2 hybridization
  • A C bonded to 1 H and 1 C with a triple bond (like in ethyne) has a sp hybridization.

Analyzing the type and amount of unions of the nitrogen and the carbonyl you will be able to determine the hybridization.

In the imine, the N atom has a double bond to a C and a simple bond two other C, plus the lone pair of electrons (counts as a bond) so it will have a sp2 hybridization.

In the carbonyl, the C has two simple bonds to other C and a double bond to an oxygen atom. It will also have a sp2 hybridization

3 0
3 years ago
In reality, reactants don't have to react in perfect whole-numbers of moles. In a two-reactant synthesis reaction, usually one
Fofino [41]

Answer:

srry i cant help u with this im so confuse like u just put all of it on there how would anybody answer tht!

?!Explanation:

5 0
3 years ago
In the process of eating, what kind of energy in food is transformed into heat energy by your body?
Rama09 [41]

Answer:The chemical energy

Explanation:because The chemical energy in the food you eat is changed into another kind of chemical energy that your body can use. Your body then uses that energy to give you the kinetic energy that you use in everything you do.

4 0
3 years ago
Read 2 more answers
Other questions:
  • When nitrogen dioxide (NO2) from car exhaust combines with water in the air, it forms nitric acid (HNO3), which causes acid rain
    8·1 answer
  • Why are metals good conductors of heat and electricity?
    5·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Magnesium and iron are metallic elements. How does a mole of magnesium compare with a mole of iron?
    6·2 answers
  • Why does Earth rotate?
    12·2 answers
  • Which of the following is an example of a decomposition reaction
    11·1 answer
  • As a medication, Chang's doctor prescribed him a drug with serious restrictions. However, Chang started overdosing on it. This a
    7·1 answer
  • The enthalpy of vaporization of a certain liquid is found to be 14.4 kJ mol-1 at 180 K, its normal boiling point. The molar volu
    15·1 answer
  • Why are summer days longer than winter days on Earth?
    9·2 answers
  • Commercial products commonly report concentration in terms of "percentage." Using this
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!