1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
4 years ago
13

Deborah recently went through menopause and is finding that maintaining her weight isn't as easy as it used to be and she would

like to lose weight. Her husband is not supportive of exercise, and Deborah is not motivated without his support. What is the best exercise-self regulation strategy for helping Deborah begin a successful exercise program?
Health
2 answers:
Studentka2010 [4]4 years ago
6 0

Answer:

Re visit Deborah's motivations for exercise, and encourage her to replace her weight loss goals with goals related to meeting new people, relieving stress, and feeling good.

Explanation:

The best exercise-self regulation strategy for helping Deborah begin a successful exercise program is by encouraging her to try and replace her thought of losing weight with meeting new people, stress relief and always feeling good since her husband was not in support of the weight loss exercise.

Vinil7 [7]4 years ago
3 0

Answer: The options are given below:

a) revisit Deborah's motivations for exercise, and encourage her to replace her weight loss goals with goals related to meeting new people, relieving stress, and feeling good.

b) Deborah should be motivated through using tape measurements and scale measurements at least once a week so she can see she is on target to lose weight.

c) encourage Deborah to set a goal of losing 2 pounds a week so she has something measurable to obtain each and every week.

d) consider encouraging Deborah to have a serious conversation with her husband about how important staying active is to her and how she needs his support in order to be successful.

The correct option is A.

Explanation:

The best strategy is to revisit Deborah's motivations for exercise, and encourage her to replace her weight loss goals with goals related to meeting new people, relieving stress, and feeling good.

This will help Deborah live healthily because she feels undisturbed about the lack of support from her husband.

You might be interested in
1. The two health-related components of fitness are muscular strength and muscular endurance.
Vladimir [108]

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

Below are the answers to the above questions:

1) true 
<span>2) false </span>
<span>3) false </span>
<span>4) true </span>
<span>5) false </span>
<span>6) true </span>
<span>7) false </span>
<span>8) true </span>
<span>9) false </span>
<span>10) false </span>
8 0
3 years ago
Read 2 more answers
What are 5 companies that offer health insurance. Explain what makes each one different.
Slav-nsk [51]
1) Kimley-Horn and Associates

What the company offers: Covers 100% of an employee's healthcare premium and 90% of his or her dependents' premiums. Employees have the option to upgrade their plan for partial premium coverage. Includes dental, vision, prescription drug subsidy and access to mental health care.

Domestic partner coverage? Yes, for both same-sex and opposite-sex couples.

Part-time eligibility?: The company covers 92% of a part-time employee's healthcare premium when he or she works at least 30 hours a week.

What the company has to say about the benefit: 

"We like to communicate to our employees that this is a great place to spend a career," said Barry Barber, the executive vice president of human resources at Kimley-Horn. "It's just one more example of why this is a great place to be, and we believe shows employees that we we're a company that's really looking out for them and their families."


2)

Arthrex

What the company offers: Covers 100% of an employee's healthcare premium and 50% of his or her dependents' premiums. Includes dental, vision, prescription drug subsidy and access to mental health care.

Domestic partner coverage? No.

Part-time eligibility?: The company covers part-time employees' premiums when they work at least 29 hours a week.

Special perks: Arthrex has an on-site medical clinic with a staff of 12 that's free for all employees and their dependents. Includes a small pharmacy. The clinic operates as both a primary and urgent care outlet.

What the company has to say about the benefit:

"It's something we've always done. It goes along with our culture and family atmosphere here," said Lindsay Horne, who manages Arthrex's compensation and benefits. "Our mission is helping surgeons treat their patients better, likewise we want to help treat our employees better. We see that as a spinoff of our mission."


3)

Ultimate Software

What the company offers: Covers 100% of an employee's healthcare premium and 100% of his or her dependents' premiums. Includes dental, vision, prescription drug subsidy and access to mental health care.

Domestic partner coverage? Yes, for same-sex couples only.

Part-time eligibility?: No.

What the company has to say about the benefit:

"Our CEO did this from the beginning. There were several times along the way after we became a public company that he was questioned on the policy, but he stuck by it," said Linda Miller, the executive of public relations for Ultimate Software. "It's a high ticket item for the company, but he has always strongly believed that it's the quality of the talent that you hire and their commitment that ultimately results in the quality of our products and services. He wants to take care of the employees, but he also knows it's a huge benefit to the company in how the employees feel."


4)

Perkins Coie

What the company offers: Covers 100% of an employee's healthcare premium and 50% of his or her dependents' premiums. Includes dental, vision, prescription drug subsidy and access to mental health care.

Domestic partner coverage? Yes, for both same-sex and opposite-sex couples.

Part-time eligibility?: The company covers 80% of part-time employees' premiums when they work at least 19 hours a week.

Special perks: Coverage includes fertility treatments.

What the company has to say about the benefit: "It's part of our overall strategy. Our culture and our people are significantly important to us," said Darrin Emerick, chief personnel officer for Perkins Coie. "While the partners and attorneys generally make higher salaries, we want to treat everyone fairly. By providing low-cost healthcare, we're able to equate fairness with our benefit programs. Everyone should feel they have the ability to afford their healthcare."


5)

FactSet Research Systems

What the company offers: Covers 100% of an employee's healthcare premium and 100% of his or her dependents' premiums. Includes dental, vision, prescription drug subsidy and access to mental health care.

Domestic partner coverage? Yes, for both same-sex and opposite-sex couples.

Part-time eligibility?: The company covers 100% of part-time employees' premiums when they work at least 30 hours a week.

Special perks: Coverage includes fertility treatments.

What the company has to say about the benefit: "FactSet realizes it needs to support employees not only in the work environment but also at home and in the communities where they live," said Jennifer Passeck, a lead recruiting specialist for FactSet. "When employees feel they're part of a team that cares for them and values them as individuals, it creates an appreciation for what's offered and a desire to make their team proud."

8 0
3 years ago
Read 2 more answers
HI REX2209 How is your day today:)
tino4ka555 [31]

Answer:

what cinfused

Explanation:

3 0
3 years ago
Read 2 more answers
The breaking down of food in the alimentary canal is called?
blagie [28]
Digestion! It is a group of organs in the body which work together to digest food. Digestion is the process by which our body breaks down food into substances we can take in (absorb) and use. Food travels through the alimentary canal which starts at mouth and ends at the anus.
8 0
3 years ago
Shereen was rock climbing when she injured a tendon in her wrist while grabbing onto a rock. What kind of injury has she sustain
gulaghasi [49]
1) Shereen sustained a strain.

2) Terence sustained a sprain.
6 0
3 years ago
Other questions:
  • Which of the following is often found in individuals who are active and eating a healthy diet?
    7·1 answer
  • What is the difference between dna and rna
    9·2 answers
  • TADRA is an acronym for georgia
    11·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • How would you give CPR to a dog?
    15·2 answers
  • I need help with this question
    12·2 answers
  • Which of the following is an example of specific immunity?
    11·2 answers
  • Why does brainly charge for questions?
    9·1 answer
  • I need help with this
    8·2 answers
  • Hey um i just wanna tell you that im proud of you and i appreciate you
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!