1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
otez555 [7]
3 years ago
6

Iron and oxygen react together to make iron (III) oxide (rust). You know that this is a chemical reaction and not a nuclear reac

tion because:
a large amount of heat is produced by the reaction
the individual atoms are rearranged but do not change identity
new products are formed as a result of the reaction
the rust has a greater mass than the iron and oxygen used to produce it
Chemistry
2 answers:
Alona [7]3 years ago
7 0
The atoms didn't change we only added 2 different ones together. 2nd one is right
viva [34]3 years ago
6 0

Answer:

The individual atoms are rearranged but do not change identity

Explanation:

Hi, identity of an element is given by the amount of protons it has in its nucleous: two different elements must have different amounts of protons.

During a chemica reaction, such as the one between oxygen and iron, the atoms of the two elements create bonds but no a new element: they identities remain intact, so this is not a nuclear reaction

You might be interested in
Explain and describe how the photoelectric effect occurs on an atomic level in terms of protons, neutrons, and electrons
grin007 [14]

Answer:

The photoelectric effect is the emission of electrons when electromagnetic radiation, such as light, hits a material. Electrons emitted in this manner are called photoelectrons.

Based on the wave model of light, physicists predicted that increasing light amplitude would increase the kinetic energy of emitted photoelectrons, while increasing the frequency would increase measured current.

3 0
2 years ago
Gold has a specific heat of 0.126 J/g.C. Copper has a specific heat of 0.386 J/g C. Which of the two metals would require more
ASHA 777 [7]

Answer:

The copper, because its specific heat is higher, meaning it takes more heat (Joules) per gram to raise the temperature 1 degree Celsius.

Explanation:

8 0
2 years ago
If volume is increased, the number of<br> collisions per second
frutty [35]

Answer:

Decreases

Explanation:

The particles have more space to move and will be less likely to collide.

5 0
3 years ago
When of alanine are dissolved in of a certain mystery liquid , the freezing point of the solution is less than the freezing poin
vitfil [10]

Answer:

16.5 g

Explanation:

The van't Hoff factor is a relation between the ideal value of a solution's colligative properties and the observed colligative properties.

Check the attached files for detailed solution

7 0
3 years ago
The solution of this problem with explaining the solution?
maw [93]
I need a closer pic
5 0
3 years ago
Other questions:
  • Which best describes the tyndall effect? the scattering of light by solutes in a mixture the scattering of light by solvent in a
    15·2 answers
  • When must scientist conduct controlled experiments ?
    13·1 answer
  • A plastic 2L soda bottle is flexible enough that the volume of the bottle can change even without opening it. If you have an emp
    11·1 answer
  • On a microscopic scale, mass can be shown to be conserved as...
    7·1 answer
  • Alcohol is a ______ drug that affects your coordination, judgment, perception, and emotional state.
    15·1 answer
  • A solution is made by dissolving 10.20 grams of glucose (C6H12O6) in 355 grams of water. What is the freezing point depression o
    9·1 answer
  • HELP!!!!!!!!!!!!!!
    9·2 answers
  • ‼️ i really need help. if anyone can do 10 pages of a grade 11 chemistry packet (multiple choice) let me know. i can pay money
    6·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What animal did this person tes<br> on to see if the air was pure<br> nitrogen?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!