1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
3 years ago
15

A student titrates a 20.00 mL sample of an aqueous borax solution with 1.03 M H2SO4. If 2.07 mL of acid are needed to reach the

equivalence point, then what is the molarity of the borax solution
Chemistry
1 answer:
RSB [31]3 years ago
6 0

Answer:

The concentration of the borax solution is 0.1066 M

Explanation:

Step 1: Dtaa given

Volume of a sample of aqueous borax solution = 20.00 mL = 0.020 L

Molarity of H2SO4  = 1.03 M

Volume of the H2SO4 = 2.07 mL = 0.00207 L

Step 2: The balanced equation

Na2B4O7*10H2O(borax) + H2SO4 ⇆ Na2SO4 + 4 H3BO3 + 5 H2O

Step 3: Calculate molarity of borax solution

b*Ca*Va = a * Cb*Vb

⇒with B = the coefficient of H2SO4 = 1

⇒with Ca = the concentration of borax = TO BE DETERMINED

⇒with Va = the volume of borax = 0.020 L

⇒with a = the coefficient of borax = 1

⇒with Cb = the concentration of H2SO4 = 1.03 M

⇒with Vb = the volume of H2SO4 = 0.00207 L

Ca*0.020 L = 1.03 M * 0.00207 L

Ca = (1.03 * 0.00207) / 0.020

Ca = 0.1066 M

The concentration of the borax solution is 0.1066 M

You might be interested in
Frequency of 6.98 x 1013
MAVERICK [17]

Answer:7,070.74

Explanation:because frequency has a lot of energy

6 0
2 years ago
How many moles of HCl are required to neutralize 20.0 mL of 1.5 M KOH?
777dan777 [17]
Barbershop kennel and gabby park on north fort park in north north corner park on the park and park north of fort creek road park north west north of fort park north park park west west corner bein north park north north of fb f fbfu
Jellyfish and not iOS games jahnel is the best thing that can I do have
8 0
2 years ago
What molecules can cells break down for energy?
Orlov [11]

Answer: I think the answer is C)

Explanation:

6 0
3 years ago
2. What are the factors that influence the two types of energy?
VikaD [51]

Answer:

It depends on the objects mass, the gravitational pull when up or down slopes, and the height of the reference point

3 0
2 years ago
Determine the mass in grams of Avogadro's number of C12H22O11
Allushta [10]

Answer:

2.059524x10^26 if im not wrong

Explanation:

avogadro's number is 6.022x10^23

5 0
2 years ago
Other questions:
  • Which formula equation represents the burning of sulfur to produce sulfur dioxide
    11·1 answer
  • The combustion of 1.00 mol of glucose, C6H12O6, releases 2820 kJ of heat. If 2.0 g of glucose is burned in a calorimeter contain
    15·1 answer
  • Calculate the density in g/l of co2 gas at 27 Celsius and 0.500 atm pressure
    11·1 answer
  • Pomocy zadanie na jutro chemia czesc 1 str 71 zadania 48 i 49
    6·1 answer
  • What is 8÷39.2 help me please
    6·1 answer
  • What is the bond order of N2+
    7·1 answer
  • What is the frequency of gravity
    11·1 answer
  • Anybody wanna help me with number 22? (Chemistry)
    9·1 answer
  • If an ion has 26 protons and 24 electrons what is the charge on the ion
    6·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!