1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
3 years ago
13

Give the characteristics of a strong acid.

Chemistry
1 answer:
Novosadov [1.4K]3 years ago
4 0
The correct answer is d
You might be interested in
How many grams of Cl2 are in 1.20 x 1024 Cl atoms?
Vaselesa [24]
<h3>Answer:</h3>

70.906 g

<h3>Explanation:</h3>

We are given;

  • Atoms of Chlorine = 1.2 × 10^24 atoms

We are required to calculate the mass of Chlorine

  • We know that 1 mole of an element contains atoms equivalent to the Avogadro's number, 6.022 × 10^23.
  • That is , 1 mole of an element = 6.022 × 10^23 atoms
  • Therefore; 1 mole of Chlorine = 6.022 × 10^23 atoms

But since Chlorine gas is a molecule;

  • 1 mole of Chlorine gas = 2 × 6.022 × 10^23 atoms

But, molar mass of Chlorine gas = 70.906 g/mol

Then;

70.906 g Of chlorine gas = 2 × 6.022 × 10^23 atoms

                                          = 1.20 × 10^24 atoms

Thus;

For 1.2 × 10^24 atoms ;

= ( 70.906 g/mol × 1.2 × 10^24 atoms ) ÷ (1.20 × 10^24 atoms)

<h3>=  70.906 g </h3>

Therefore, 1.20 × 10^24 atoms of chlorine contains a mass of 70.906 g

=  

5 0
3 years ago
How many atoms are in 10.0 moles of titanium
Tema [17]
The answer should be 479 i could possibly be wrong but that’s what i got because one mole is 47.90 grams
8 0
2 years ago
(vii). Give two uses of chlorine gas.​
Strike441 [17]

Answer: A yellowy-green dense gas with a choking smell. Chlorine kills bacteria – it is a disinfectant. It is used to treat drinking water and swimming pool water. It is also used to make hundreds of consumer products from paper to paints, and from textiles to insecticides.

Explanation: hope this helps u! HAppy Holidays!  

7 0
3 years ago
½H2(g) + ½I2(g) → HI(g), ΔH = +6.2 kcal/mole 21.0 kcal/mole + C(s) + 2S(s) → CS2(l) What type of reaction is represented by the
wlad13 [49]

<u>Answer:</u>

Exothermic Reaction are those reaction, in which energy is released while in endothermic reaction are those, in which energy is absorbed.

<u>Explanation:</u>

First Reaction:

As in this reaction, energy is released

½H2(g) + ½I2(g) → HI(g), ΔH = +6.2 kcal/mole

so it is <em>exothermic reaction</em>

Second reaction:

As in this reaction, energy is absorbed

21.0 kcal/mole + C(s) + 2S(s) → CS2(l)

so it is <em>endothermic reactions</em>.


7 0
3 years ago
Read 2 more answers
Can someone please help I’ll give brainliest!!!
padilas [110]
Single replacement because only one letter is being switched out in the reaction
5 0
2 years ago
Other questions:
  • Convert 86,000 cm into km
    6·2 answers
  • How does adversity lead to change?​
    6·1 answer
  • How sig figs are in 28.0
    12·2 answers
  • According to the kinetic-molecular theory of gases, molecules of an ideal gas
    11·1 answer
  • The combustion of octane, C8H18, proceeds according to the reaction
    13·2 answers
  • Describe general characteristics of potassium
    14·1 answer
  • Balance Cr2O3+Mg --&gt;Cr + MgO
    8·1 answer
  • Which of the following represents an endothermic reaction?
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • PLEASE I WILL GIVE BRAINLISET PLS HELPPPP
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!