1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
3 years ago
8

How to draw lewis dot structure of BH2-

Chemistry
1 answer:
frosja888 [35]3 years ago
6 0
I am attaching a picture cause I cannot write it directly

Hope it helps
Plz mark as brainliest
You might be interested in
Identify the compounds that are soluble in both water and hexane. identify the compounds that are soluble in both water and hexa
Reika [66]
<span>The correct answer would be the fourth option. The compounds ethanol and 1-propanol are soluble to both water and hexane. Ethanol and 1-propanol are completely soluble in water as they both contain a polar end due to the hydrogen bonding present in the -OH functional group. Both are soluble in hexane since both contains a non polar end, the aliphatic hydrocarbon chain. Solubility of alcohols varies increasingly as the hydrocarbon chain increases since it makes them more non polar. However, for branched molecules, non polar properties would decrease. So, the best option from the list of choices would be ethanol and 1-propanol.</span>
4 0
3 years ago
Read 2 more answers
What is the total pressure in a container with 256 mm Hg of Oz, 198 mm Hg of He,
irina1246 [14]

Answer:

P(total pressure) = 504 mmHg = 504mm/760mm/atm = 0.663 atm

Explanation:

Apply Dalton's Law of Partial Pressures.

P(total) = ∑Partial Pressures = ∑(256mm + 198mm + 48mm) = 504 mmHg

P(total pressure) = 504 mmHg = 504mm/760mm/atm = 0.663 atm

7 0
2 years ago
Name two fluid technologies that make use of air.
MariettaO [177]

Answer: an air compressor and desk chair.

Explanation:

4 0
3 years ago
A 100.0-mL sample of 1.00 M NaOH is mixed with 50.0 mL of 1.00 M H2SO4 in a large Styrofoam coffee cup calorimeter fitted with a
worty [1.4K]

Answer:

THE ENTHALPY CHANGE IN KJ/MOLE IS +114 KJ/MOLE.

Explanation:

Heat = mass * specific heat capacity * temperature rise

Total volume = 100 + 50 = 150 mL

Total mass = density * volume

Total mass = 1 * 150 mL = 150 g

So therefore, the heat evolved during the reaction is:

Heat = 150 * 4.18 * ( 31.4 - 22.3)

Heat = 150 * 4.18 * 9.1

Heat = 5705.7 J

Equation for the reaction:

2 NaOH(aq) + H2SO4(aq) → Na2SO4(aq) + 2 H2O(l)  

From the equation, 2 moles of NaOH reacts with 1 mole of H2SO4 to produce 1 mole of Na2SO4 and 2 moles of water

50 mL of 1 M of H2SO4 contains

50 * 1 / 1000 mole of acid

= 0.05 mole of acid

The production of 1 mole of water evolved 5705.7 J of heat and hence the enthalpy changein kJ per mole will be:

0.05 mole of H2SO4 produces 5705.7 J of heat

1 mole of H2SO4 will produce 5705.7 / 0.05 J

= 114,114 J / mole

In kj/mole = 114 kJ/mole.

Hence, the enthalpy change of the reaction in kJ /mole is +114 kJ/mole.

5 0
3 years ago
33 protons 36 electrons 45 neutrons
Artist 52 [7]

As has an atomic number of 33, so it has 33 protons.  

It has a charge of 3-, so there are three more electrons than protons. Thus, there are 36 electrons.  

It has a mass of 75, which is the sum of neutrons and protons.  

33+n=75 ---> n = 75 - 33 = 42 neutrons  

The answer is e) 33 protons, 42 neutrons and 36 electrons.

6 0
3 years ago
Other questions:
  • A temperature of 37°C is equivalent to a temperature of
    12·1 answer
  • Caco3 is an example of which type of material?
    7·1 answer
  • Which of the following statements is true?
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • 1.In class, students learned that a cart will move when a force of 50 N or greater is applied. A student pushed on the cart with
    9·1 answer
  • For each of the following
    11·2 answers
  • What does calibrating the cabbage pH indicator mean
    10·2 answers
  • The molar mass of dibromomethane (CH2Br2) is larger than the molar mass of dichloromethane (CH2Cl2).
    8·1 answer
  • Write the equation for the acid dissociation, write the Ka expression, solve for Ht concentration, then do an ICE chart. Put the
    14·1 answer
  • Umm care to help, please
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!