1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
14

1. How many periods are there in the periodic table? *

Biology
1 answer:
jok3333 [9.3K]3 years ago
3 0
The periodic Table has 7 periods and 18 groups. The number of valence electrons in an atom of sulfur is 6, calcium has 2, chlorine has 7 and arsenic has 5. The element that corresponds to the atomic number 10 is Neon, for 18 it is argon, for 36 it is krypton, and for 90 it is thorium. Na and CI belong to the same period, as does H and He. An element found in period 4 would have 4 energy levels. The transition elements are in groups 3-12. Strontium would be more chemically similar to calcium, because they are both in the same family/group. The heaviest noble gas is radon. The heaviest alkaline earth metal is radium.
You might be interested in
HELP PLEASE! Why might a scientist repeat experiment if she did not make a mistake in the first one
trasher [3.6K]

Answer:

i believe its B but i might be mistaken.

Explanation:

4 0
3 years ago
Which two organ systems regulate homeostasis in our bodies?
Usimov [2.4K]
The correct answer for the given question above would be option A. The two organ systems that regulate homeostasis in our bodies are nervous and endocrine. The nervous system is responsible in the coordination of different systems in the body, including the voluntary and involuntary function. Whereas, the endocrine system, along with the nervous system is responsible for the regulation of different hormones that are responsible for different functions in the body.
6 0
3 years ago
According to Newton’s third law of motion, which of the following best describes the forces of the tennis racket and the ball?
-BARSIC- [3]

Answer:

Newton's third law of motion is For every action, there is an equal and opposite reaction.

Explanation:

So if you throw a tennis ball and then hit it with a tennis racquet then the action would be the tennis ball and the equal and opposite reaction woul be the tennis ball bouncing off of the tennis racquet.

5 0
3 years ago
Which type of cartilage covers and protects the ends of bones at freely movable joints?
dangina [55]
<span>Thy hyaline cartilage covers and protects the ends of bones at freely movable joints. The hyaline cartilage contains elements that are found commonly in areas such as the ear. It is made this way because it is very elastic allowing the joints it is covering to have more flexibility.</span>
8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Which statement is true about nitrogen and oxygen?
    6·2 answers
  • What is an eukaryotic cell? And what is a prokaryotic cell?
    14·2 answers
  • Which is the number of characteristics that define a living thing?
    14·2 answers
  • Which process involves making glucose without energy from sunlight?
    11·2 answers
  • What are some science skills you could use to study fish in an aquarium
    14·1 answer
  • "Nigel wants to choose a lipid to use in stir-frying that is more stable and thus won't smoke and burn as readily when he cooks
    6·1 answer
  • What type of isolation was occurring in the collared lizard population?
    8·1 answer
  • Help me out with this​
    6·1 answer
  • Which organisms are not necessary for secondary succession to begin?
    5·2 answers
  • Whats a independent variable and dependent varivle
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!