1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
8

The molar heat of fusion of platinum (Pt) is 4.700 kcal/mol. How much heat must be added to 85.5 g of solid platinum at its melt

ing point to completely melt it?
Chemistry
2 answers:
Zolol [24]3 years ago
6 0
The answer is 2.06 kcal
Andre45 [30]3 years ago
4 0
The heat required to completely melt the given substance, platinum, we just have to convert first the given mass in mole and multiply the answer to its molar heat of fusion.. 
                              Hf  = mass x (1/molar mass) x molar heat of fusion
                            Hf = (85.5 g) x (1 mole/195.08 g) x 4.70 kcal/mol
                                   Hf = 2.06 kcal
You might be interested in
How many grams of CaCl, are needed to make a 15% by mass solution with 520g of water?
allsm [11]

Answer:

many

Explanation:

many many many many

5 0
2 years ago
What is the strongest type of van der Waals force that exists between molecules of ammonia, NH3?
Marianna [84]
It is hydrogen bond(as well as fh, and h2o), intermolecular force.
6 0
3 years ago
Read 2 more answers
Calculate the percent error if the experimental value for the density of zinc is 9.95g/cm3, but the accepted value is 7.13g/cm3
Pani-rosa [81]
In order to calculate the experimental percent error, we follow these steps:
1- Subtract one value from the other (order does not matter as we take absolute)
2- Divide the obtained number by the accepted or true value.
3- Multiply the fraction you got from step 2 by 100 to get the percentage of error.

Now, we will apply these steps on our problem:
1- Subtract one value from the other:
9.95 - 7.13 = 2.82
2- Divide by accepted value:
2.82 / 7.13 = 0.3955
3- Multiply by 100 to get the error percentage:
error percentage = 0.3955 x 100 = 39.55%
7 0
3 years ago
The SI unit of measure for length - the meter -would be most appropriate when
erastovalidia [21]

Answer:- The correct answer is B. measuring the height of a building.

Explanations:- Insects and ants are very small. So, meter is not the right unit of measure their length. Their lengths would be measure in mm that is millimeters. So, options A and C are not good.

The distance between two cities is mostly too much so it's measured in kilometers or miles. So, D is also not good.

Height of buildings is measured in meters and so the correct option is B.


7 0
3 years ago
Using 21st-century technology, hydrogen fusion requires temperatures around 10^8 K. But, lower initial temperatures are used if
Bezzdna [24]

<u>No, the captain should continue using the current technology.</u>

<u></u>

<h3>How Nuclear Fusion Reactors Work?</h3>

­W­hen hydrogen atoms fuse, the nuclei must come together. However, the protons in each nucleus will tend to repel each other because they have the same charge (positive). If you've ever tried to place two magnets together and felt them push apart from each other, you've experienced this principle firsthand.

To achieve fusion­, you need to create special conditions to overcome this tendency. Here are the conditions that make fusion possible:

High temperature gives the hydrogen atoms enough energy to overcome the electrical repulsion between the protons.

  • Fusion requires temperatures of about 100 million Kelvin (approximately six times hotter than the sun's core).
  • At these temperatures, hydrogen is a plasma, not a gas. Plasma is a high-energy state of matter in which all the electrons are stripped from atoms and move freely about.
  • The sun achieves these temperatures by its large mass and the force of gravity compressing this mass in the core. We must use energy from microwaves, lasers and ion particles to achieve these temperatures.

High pressure squeezes the hydrogen atoms together. They must be within 1x10-15 meters of each other to fuse.

  • The sun uses its mass and the force of gravity to squeeze hydrogen atoms together in its core.
  • We must squeeze hydrogen atoms together by using intense magnetic fields, powerful lasers or ion beams.

Learn more about Fusion

brainly.com/question/9464925

#SPJ4

3 0
1 year ago
Other questions:
  • The lower the percent of energy required for a machine to perform work, the more energy efficient it is. Please select the best
    5·2 answers
  • Looking at the structure of caffeine, explain why it is very soluble in a non-polar solvent and a little soluble in water.
    14·1 answer
  • Three chemistry students measured the length of a copper bar. The recorded lengths were 5.05 cm, 5 cm , and 5.1 cm, What is the
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Charles's law is an experimental gas law that shows the relationship between the temperature of a gas and its corresponding volu
    10·1 answer
  • 2. What element could contain seven protons, eight neutrons, and seven electrons?
    8·1 answer
  • Mass in grams of 4.26 mol Si
    14·2 answers
  • I NEED HELP! If you can
    10·1 answer
  • An aqueous solution of 1.29 M ethanol, CH3CH2OH, has a density of 0.988 g/mL. The percent by mass of CH3CH2OH in the solution is
    7·1 answer
  • A reproducible measurement is an accurate one. A. True B. False
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!