1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prohojiy [21]
3 years ago
5

Which indicator is yellow in a solution with a pH of 9.8?

Chemistry
2 answers:
Vlada [557]3 years ago
8 0
It's the Methyl Orange. 
at about 4.4 pH, it changes from red to Yellow, to indicate an acid solution.
This pH indicator is normally used in titration of acids.

Hope this Helps :)
Mama L [17]3 years ago
6 0

Answer:

1) Methyl orange

Explanation:

Acid base indicators are solutions of certain dyes that bring about a color change at a certain pH i.e. the at a particular H+ ion concentration.

The color change and the pH range for the four indicators mentioned in the question are as follows:

 indicator                            pH range             color change

1. Methyl orange                  3.2-4.4                 red-yellow

2. Bromothymol blue           6.0-7.6                yellow-blue

3. Bromocresol green          3.8-5.4                yellow-green

4. Thymol blue                      8.0-9.6               yellow-blue

Based on the above data, only methyl orange is yellow at pH above 4.4. Hence,  indicator is yellow in a solution with a pH of 9.8 is methyl orange

You might be interested in
Calculate the molality of a solution that contains 51.2 g of naphthalene, C10H8, in 500 mL of carbon tetrachloride. The density
PtichkaEL [24]

<u>Answer:</u> The molality of naphthalene solution is 0.499 m

<u>Explanation:</u>

Density is defined as the ratio of mass and volume of a substance.

\text{Density}=\frac{\text{Mass}}{\text{Volume}} ......(1)

Given values:

Volume of carbon tetrachloride = 500 mL

Density of carbon tetrachloride = 1.60 g/mL

Putting values in equation 1, we get:

\text{Mass of carbon tetrachloride}=(1.60g/mL\times 500mL)=800g

Molality is defined as the amount of solute expressed in the number of moles present per kilogram of solvent. The units of molarity are mol/kg. The formula used to calculate molarity:

\text{Molality of solution}=\frac{\text{Given mass of solute}\times 1000}{\text{Molar mass of solute}\times \text{Mass of solvent (in g)}} .....(2)

Given values:

Given mass of naphthalene = 51.2 g

Molar mass of naphthalene = 128.17 g/mol

Mass of solvent = 800 g

Putting values in equation 2, we get:

\text{Molality of naphthalene}=\frac{51.2\times 1000}{128.17\times 800}\\\\\text{Molality of naphthalene}=0.499m

Hence, the molality of naphthalene solution is 0.499 m

4 0
2 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
How could a solid dissolve in a water solution if a base was added such<br> as NaOH
irina [24]

Answer:

ELALUMINO

I

Explanation:

6 0
2 years ago
What mass of NaCl is dissolved in 150 g of water in a .050<br> msolution?
mart [117]

Answer:

0.4383 g

Explanation:

Molality is defined as the moles of the solute present in 1 kg of the solvent.

It is represented by 'm'.

Thus,  

Molality\ (m)=\frac {Moles\ of\ the\ solute}{Mass\ of\ the\ solvent\ (kg)}

Given that:

Mass of solvent, water = 150 g = 0.15 kg ( 1 g = 0.001 g )

Molality = 0.050 m

So,

0.050=\frac {Moles\ of\ the\ solute}{0.15}

Moles = 0.050\times 0.15\ mol= 0.0075\ mol

Molar mass of NaCl = 58.44 g/mol

Mass = Moles*Molar mass = 0.0075\times 58.44\ g = 0.4383 g

6 0
3 years ago
When you heat an air-filled balloon, what happens inside with regard to the movement of air molecules?
rodikova [14]
They heat up which helps the balloon fly
3 0
3 years ago
Other questions:
  • A student wants to reclaim the iron from an 18.0-gram sample of iron(III) oxide, which
    10·2 answers
  • Calculate the pH of a 0.50 M HIO. The Ka of hypoiodic acid, HIO, is 2.3x10–11.0.305.325.479.474.80
    5·1 answer
  • A chemist determined by measurements that moles of calcium sulfide participate in a chemical reaction. Calculate the mass of cal
    12·1 answer
  • A student wants to prepare a solution of cobalt(II) fluoride with a known molarity.
    12·1 answer
  • How do take off my question when I don't have a question?
    5·2 answers
  • News shows evidence of being plagiarized
    11·1 answer
  • Brass is an example of
    5·1 answer
  • Please match word and definition &lt; electrons and electric current move easily 1. electric current &lt; Prevents electrons fro
    13·1 answer
  • Which of these is a covalent compound?<br><br> A. LiCl<br> B. MgO<br> C. AlCl3<br> D. CO
    6·1 answer
  • How do plants convert glucose to energy?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!