Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
V=0.3×22.4=6.72 liters hope this helps
Answer:
is an aqueous reactant
is a liquid product
is a gaseous product
Explanation:
⇔ 
Hydrogen carbonate dissocates to form carbon dioxide and water. The acid (hydrogen carbonate) is in aqueous form and it dissociates to water (liquid) and carbon dioxide (a gas). It is also seen that the hydrogen carbonate is on the reactant side and it dissociates to produce water and carbon dioxide.
W<u> is an aqueous reactant</u> (a reactant undergoes changes in a chemical reaction
<u />
<u> is a liquid product</u> (product refers to the species produced from chemical reaction)
<u />
<u> is a gaseous product</u>
Answer:
Winnowing
Explanation:
Wind blows the lighter(in terms of mass) chaff from the whole grains,which are heavier(in terms of mass)
Answer:
A) 7.9 x 10⁶ inches
B) 1004 g
C) 2.8 x 10³ inches/ min
D) 1.2 x 10⁻⁴ mm
Explanation:
A) Since 39.37 inches = 1 m, you can convert meters to inches by multiplying by the conversion factor (39.37 inches / 1 m).
Notice that if 39.37 inches = 1 m then 39.37 inches / 1 m = 1. That means that when you multiply by a conversion factor, you are only changing units since it is the same as multiplying by 1 :
2.0 x 10⁵ m * (39.37 inches / 1 m) = 7.9 x 10⁶ inches
B) Conversion factors : (2.205 pounds / 1 kg) and (453.59 g / 1 pound), because 2.205 pounds = 1 kg and 1 pound = 453.59 g. Then:
1.004 kg * ( 2.205 pounds / 1 kg) * ( 453.59 g / 1 pound) = 1004 g
C) Conversion factor: (39.37 inches / 1 m) and (60 s / 1 min)
1.2 m/s * (39.37 inches / 1 m) * ( 60 s / 1 min) = 2.8 x 10³ inches/ min
D)Converison factor ( 1 mm / 1 x 10⁶ nm):
120 nm (1 mm / 1 x 10⁶ nm) = 1.2 x 10⁻⁴ mm
