1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
10

Which property would cesium most likely have?

Chemistry
2 answers:
Romashka-Z-Leto [24]3 years ago
8 0
The answer is a because its not low ductile or gasst

ivolga24 [154]3 years ago
8 0

Answer: Option (B) is the correct answer.

Explanation:

Cesium is a group 1A element and therefore, it is a metal. Alkali metals are soft, malleable and ductile.

And, group 1A elements being metals are good conductors of heat and electricity.

Group 1A elements are highly reactive in nature. Hence, cesium is also reactive in nature.  Also, cesium is not a gas.

Therefore, we can conclude that a property cesium would most likely have is that it is ductile.

You might be interested in
In the following equation, ______ is being oxidized and ______ is being reduced.
Mashcka [7]

oxidation \: number \: of \: oxygen =  \\ before \: rxn =  - 2 \\ after \: rxn =  - 2

oxidation \: number \: of \: hydrogen = \\ before \: rxn =  + 1 \\ after \: rxn =  \\ 2x - 2 = 0 \\ x =  + 1

oxidation \: number \: of \: carbon =  \\ before \: rxn =  \\ x  - 6 =  - 2 \\ x = 4 \\ after \: rxn =  \\ x - 4 = 0 \\ x = 4

<h2>Option A</h2>

oxidation \: numbers \: remain \: constant \\ so \: none \:a re \: undergoing \: oxidation \: \\ nor \: reduction \:

6 0
2 years ago
How do you get the electron configuration for an anion?
MissTica

Answer:

Anions electronic configuration is given by adding electrons.

4 0
3 years ago
Which concept can explain the acidic character of Carbon dioxide?​
Mamont248 [21]

Answer:

The concept of lewis acids and bases can explain the acidic nature of CO2. A lewis acid is a compound which can accept an electron pair whereas a lewis base is a compound which can donate an electron pair. CO2 acts as a lewis acid.

5 0
2 years ago
Read 2 more answers
I'm redoing the Heat of Combustion Lab for a better grade and I REALLY need the answers and work for all questions! PLEASE!
I am Lyosha [343]

Answer:

Hi, what are the problems on the lab?

Explanation:

5 0
3 years ago
Teniendo en cuenta los siguientes fenómenos: ebullición del agua- movimiento de un cuerpo- disolución de sal en agua- combustión
miv72 [106K]

Answer:

Las siguientes son reacciones químicas;

combustión de leña

oxidación del hierro

descomposición del agua en hidrógeno y oxígeno

Explanation:

Una reacción química da como resultado la formación de una (s) sustancia (s) nueva (s), mientras que un cambio físico no conduce a la formación de una sustancia nueva.

Las siguientes son reacciones químicas;

combustión de leña: la combustión de madera implica la oxidación del carbono según la reacción; C (s) + O2 (g) -------> CO2 (g)

oxidación del hierro: La oxidación del hierro conduce a la formación de óxidos de hierro. Como; 2Fe (s) + O2 (g) ----> 2FeO (s)

descomposición del agua en hidrógeno y oxígeno: esta es una reacción química en la que el agua se descompone de la siguiente manera; 2H2O (l) -----> 2H2 (g) + O2 (g)

Todos estos procesos enumerados anteriormente conducen a la formación de nuevas sustancias, por lo tanto, son reacciones químicas.

3 0
2 years ago
Other questions:
  • Balance the following chemical equation.​​​​​​​(2)
    12·1 answer
  • HELP me quickly PLEASE!!!!
    15·1 answer
  • Why is distilled water added to the crucible after igniting the magnesium metal?
    7·2 answers
  • 1. What is the Density of an object with a mass of 46.0g and a volume of 2cc?​
    7·1 answer
  • If someone told you they had a career in either ecology, paleontology, or botany, what area of science is this?
    14·1 answer
  • When is potential energy transformed into kinetic energy?
    9·2 answers
  • What solutes are soluble in water?
    11·1 answer
  • What is the noble gas configuration of V+3
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • I need help with this ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!