1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr [31]
3 years ago
10

A scientist is observing elephants in Asia. He notices that a specific species of moth lands on the faces of the elephants. On c

loser observation, he sees that the moths irritate the eyes of the elephants and then drink the tears that emerge.
What scientific question could the scientist ask to explain this?

A.

Do other species of moths also drink elephant tears?

B.

What nutrients that moths need are in elephant tears?

C.

How can the moths be kept off the elephants' faces?

D.

all of these
Chemistry
2 answers:
Ber [7]3 years ago
7 0

Answer:

B

Explanation:

The scientific question that the scientist could ask to explain the observation is what nutrients that moths need are in the elephant tears? This question could be essential since there may be something present in the tears that is beneficial to the moth survival.

kolezko [41]3 years ago
4 0

Answer:

B: what nutrients that moths need are in the elephant tears?

Explanation:

You might be interested in
What are some of the forms of energy you used today? How did you use them?
klio [65]

Answer:

Heat or Thermal energy, Solar Energy, Chemical energy, electrical energy, mechanical energy

Explanation:

8 0
3 years ago
Write the name and molecular formula of an organic compounds having its name suffixed with -ol and having 2 carbon atoms in the
777dan777 [17]

Ethanol C₂H₆O

Explanation:

When ethanol (CH₃-CH₂-OH) is heated in the presence of the sulphuric acid (H₂SO₄) it will produce ethylene (CH₂=CH₂ ) and water (H₂O).

CH₃-CH₂-OH → CH₂=CH₂ + H₂O

Learn more about:

sulphuric acid

brainly.com/question/867125

#learnwithBrainly

4 0
3 years ago
How many electrons must Aluminum lose or gain to obtain a noble gas<br> electron configuration? *
BaLLatris [955]

Answer:

3 electrons

Explanation:

aluminum : [Ne]3s23p1 [ N e ] 3 s 2 3 p 1 . It loses 3 electrons from 3s and 3p orbitals and attains the noble gas configuration of Neon.

6 0
3 years ago
Read 2 more answers
Benzoic acid, c6h5cooh, has a ka = 6.4 x 10-5. what is the concentration of h3o+ in a 0.5 m solution of benzoic acid? 3.2 x 10-5
FinnZ [79.3K]
The answer for this issue is: 
The chemical equation is: HBz + H2O <- - > H3O+ + Bz- 
Ka = 6.4X10^-5 = [H3O+][Bz-]/[HBz] 
Let x = [H3O+] = [Bz-], and [HBz] = 0.5 - x. 
Accept that x is little contrasted with 0.5 M. At that point, 
Ka = 6.4X10^-5 = x^2/0.5 
x = [H3O+] = 5.6X10^-3 M 
pH = 2.25
(x is without a doubt little contrasted with 0.5, so the presumption above was OK to make) 
3 0
4 years ago
X là este no, đơn chức, mạch hở. Xà phòng hóa một lượng cần 100ml dung dịch KOH 1M , thu được 11,2 gam muối ; và 3,2 gam ancol.
Evgesh-ka [11]

Answer:

Giá trị xà phòng hóa hoặc số xà phòng hóa (SV hoặc SN) biểu thị số miligam kali hydroxit (KOH) hoặc natri hydroxit (NaOH)

3 0
3 years ago
Other questions:
  • Pls help :(
    6·2 answers
  • In a chemical reaction, 36 grams of hydrochloric acid reacts with 40 grams of sodium hydroxide to produce sodium chloride and wa
    7·2 answers
  • In a first-order reaction, how does the rate change if the concentration of the reactant decreases to one-third its original val
    14·2 answers
  • How to calculate the atomic mass of Cl​
    9·1 answer
  • Identifying characteristics of atoms, using the periodic table, complete the table to describe each atom.
    5·2 answers
  • Your answer should have the same number of significant figures as the starting measurement.
    15·1 answer
  • How would a system in which both matter and energy are exchanged freely between the system and the surroundings be classified? (
    12·1 answer
  • How are ironic bonds and covalent bonds different and how are they different?
    11·1 answer
  • Chemical Equations and Reactions WS
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!