Autosomal recessive: cystic fibrosis (CF), sickle cell anemia (SC), Tay Sachs disease. Genes are inherited from our biological parents in specific ways. One of the basic patterns of inheritance of our genes is called autosomal recessive inheritance.
Answer:
3
Explanation:
The mass has 4 sig digits.
The volume has 3 sig digits
The density is = 11.50/9.03 = 1.2735
To 3 sig digits (determined by 9.03) the answer would be 1.27 gram/mL
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Hello!
I believe it is called Condensation
Condensation is when the water vapor (gas) in the air turns into a liquid. (Like the fog on a mirror after you take a hot shower)
