1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
3 years ago
10

If temperature is held constant for an ideal gas, as P and V change for a given gas sample, the PV of products will_____. increa

se decrease be constant change
Chemistry
2 answers:
noname [10]3 years ago
6 0

Answer:

The PV of products will be constant.

Explanation:

Ideal gas equation-   PV = nRT

where P is pressure of gas, V is volume of gas, n is number of moles of gas, R is gas constant and T is temperature (in Kelvin) of gas.

Now, number of moles of a gas remain constant with change in state variables.

So, if T is constant then the term "nRT" remins constant.

As PV is equal to nRT therefore PV will be constant if temperature is held constant.

In another way we can say if P is increased then V will decrease or vice versa.

vodka [1.7K]3 years ago
3 0

Answer:

PV=nRT

Explanation:

V=<u>R</u><u>T</u><u>n</u>

P

rearrangement gives

  • PV=nRT
  • R=<u>P</u><u>V</u>

nT

where P=pressure

V=volume

n=number of moles

R=ideal gas(0.0820atmdm/3 mol/k)

T=temperature in kelvin

You might be interested in
Calculate the percent of each component in the mixture. Show your calculations. Circle final answers.
Colt1911 [192]

Answer:

See Explanation

Explanation:

The question is incomplete; as the mixtures are not given.

However, I'll give a general explanation on how to go about it and I'll also give an example.

The percentage of a component in a mixture is calculated as:

\%C_E = \frac{E}{T} * 100\%

Where

E = Amount of element/component

T = Amount of all elements/components

Take for instance:

In (Ca(OH)_2)

The amount of all elements is: (i.e formula mass of (Ca(OH)_2))

T = 1 * Ca + 2 * H + 2 * O

T = 1 * 40 + 2 * 1 + 2 * 16

T = 74

The amount of calcium is: (i.e formula mass of calcium)

E = 1 * Ca

E = 1 * 40

E = 40

So, the percentage component of calcium is:

\%C_E = \frac{E}{T} * 100\%

\%C_E = \frac{40}{74} * 100\%

\%C_E = \frac{4000}{74}\%

\%C_E = 54.05\%

The amount of hydrogen is:

E = 2 * H

E = 2 * 1

E = 2

So, the percentage component of hydrogen is:

\%C_E = \frac{E}{T} * 100\%

\%C_E = \frac{2}{74} * 100\%

\%C_E = \frac{200}{74}\%

\%C_E = 2.70\%

Similarly, for oxygen:

The amount of oxygen is:

E = 2 * O

E = 2 * 16

E = 32

So, the percentage component of oxygen is:

\%C_E = \frac{E}{T} * 100\%

\%C_E = \frac{32}{74} * 100\%

\%C_E = \frac{3200}{74}\%

\%C_E = 43.24\%

5 0
3 years ago
A sample of gas with an initial volume of 12.5 L at a pressure of 784 torr and a temperature of 295 K is compressed to a volume
Kipish [7]

Answer:

Final pressure in (atm) (P1) = 6.642 atm

Explanation:

Given:

Initial volume of gas (V) = 12.5 L

Pressure (P) = 784 torr

Temperature (T) = 295 K

Final volume (V1) = 2.04 L

Final temperature (T1) = 310 K

Find:

Final pressure in (atm) (P1) = ?

Computation:

According to combine gas law method:

\frac{PV}{T} =\frac{P1V1}{T1} \\\\\frac{(784)(12.5)}{295} =\frac{(P1)(2.04)}{310}\\\\33.22 = \frac{(P1)(2.04)}{310}\\\\P1=5,048.18877

⇒ Final pressure (P1) = 5,048.18877 torr

⇒ Final pressure in (atm) (P1) = 5,048.18877 torr / 760

⇒ Final pressure in (atm) (P1) = 6.642 atm

3 0
4 years ago
How do molecular bonds form?
vaieri [72.5K]

Answer:

"A molecular, or covalent bond, is formed when atoms bond by sharing pairs of electrons. This sharing can occur from atom to atom, or from an atom to another molecular bond."

Explanation:

Google

8 0
3 years ago
Read 2 more answers
Assume that the test tube shown started out having 10.00 g of mercury(II) oxide. After heating the test tube briefly, you find 1
anyanavicka [17]

This problem is providing information about the initial mass of mercury (II) oxide (10.00 g) which is able to produce liquid mercury (8.00 g) and gaseous oxygen and asks for the resulting mass of the latter, which turns out to be 0.65 g after doing the corresponding calculations.

Initially, it is given a mass of 10.00 g of the oxide and 1.35 g are left which means that the following mass is consumed:

m_{HgO}^{consumed}=10.00g-1.35 g=8.65 g

Now, since 8.00 grams of liquid mercury are collected, it is possible to calculate the grams of oxygen that were produced, by considering the law of conservation of mass, which states that the mass of the products equal that of the reactants as it is nor destroyed nor created. In such a way, the mass of oxygen turns out to be:

m_{O_2}=8.65g-8.00g=0.65g

Learn more:

  • brainly.com/question/14502981
  • brainly.com/question/14236219
3 0
2 years ago
Which use of iron is due to its chemical properties?
Annette [7]

Answer:

changes from liquid to gas at 2,862°C

Explanation:

chemical changes are where you can't go back or change what's made. you can't change it after it's a gas.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Atomic number for bromine
    12·1 answer
  • What is the hydronium ion concentration of a 0.100 M acetic acid solution with Ka = 1.8 × 10-5? The equation for the dissociatio
    14·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Of the following gases, ______ will have the greatest rate of effusion at a given temperature.A) NH3B) CH4C) ArD) HBrE) HCl
    9·1 answer
  • At a certain temperature, the equilibrium constant, Kc, for this reaction is 53.3 At this temp, 0.3000 mol of H2 and 0.300 mol o
    10·1 answer
  • Mammals use their lungs to provide oxygen for themselves from the air. Fish spend a majority of their time in the water, and ins
    8·2 answers
  • Branches are thrown into a wood chipper and mulch is created. Chemical change or physical change?
    9·1 answer
  • List the symbol and the bonding capacity of the 4 most common elements found in
    13·1 answer
  • Annual precipitation rates can be collected for several years added together and divided by the number of years to obtain an ave
    14·1 answer
  • Sterling silver is a mixture of the metals silver and copper.It is used to make jewellery.sometimes sterling silver causes green
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!