1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frosja888 [35]
3 years ago
12

A student constructs an electrochemical cell. A diagram of the operating cell and the unbalanced ionic equation representing the

reaction occurring in the cell are shown below. The blue color of the solution in the copper half-cell indicates the presence of Cu2+ ions. The student observes that the blue color becomes less intense as the cell operates.
Identify the type of electrochemical cell represented by the diagram.
Chemistry
1 answer:
Dominik [7]3 years ago
8 0

Answer:

A voltaic cell

Explanation:

A voltaic cell is a device which converts chemical energy to electrical energy. The chemical reactions that take place inside the cell causes electrons to flow from anode to cathode hence, electricity is produced. A simple voltaic cell is made by placing two different metals in contact with an electrolyte separated by a salt bridge. The cathode is the negative electrode while the anode is the positive electrode. It is also called a galvanic cell.

In a voltaic cell having a copper/copper solution half cell, reduction occurs at the cathode. Hence, at the cathode copper II ions accept two electrons and become reduced to ordinary metallic copper. This causes the blue colour of the solution to become discharged (fade) as the cell continues to function.

You might be interested in
Classify each of the following substances:
Keith_Richards [23]

Explanation:

Carbon dioxide is a polar molecule whose positive center is on the carbon atom: This positive center is able to attract (and accept) the lone electron pairs present on the oxide ion (O2-). carbon dioxide is acts as a Lewis acid

A Lewis acid can accept a pair of electrons from a Lewis base. The boron in BF3 is electron poor and has an empty orbital, so it can accept a pair of electrons, making it a Lewis acid. A Lewis acid is defined as an electron-pair acceptor.

In CO molecule, there is a lone pair on both carbon and oxygen. The substance which can donate an electron pair are called Lewis base. It is clear that CO molecule can donate an electron pair and hence, it is a Lewis base. Also, CO can be BOTH a Lewis acid and base.

Oxygen is a Lewis base (that too a weak one), not a Lewis acid. REASON: It has lone pair of electrons, which can be donated to electron-deficient species (Lewis acids).

Methane is Neither a Lewis Acid or Lewis Base.

5 0
3 years ago
What branch of chemistry studies the flow of electrons?
grin007 [14]

Answer:

Your answer is B, Electrochemistry!

Explanation:

This is the part of chemistry that studies the chemical process in which electrons flow. This flow is called electricity. Electricity is generated by the flow of electrons, from one element to another element. This reaction is called oxidation reduction.

6 0
2 years ago
Which compounds were classified as organic compounds according to the early chemists
Temka [501]

Answer:

hope it's help you ok have a good day

4 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Which is a fossil fuel?<br> O A. Coal<br> O B. Biomass<br> O C. Geothermal<br> O D. Nuclear
creativ13 [48]

Answer:

coal

Explanation:

fossil fuels are formed by natural process.

3 0
3 years ago
Other questions:
  • Louis pasteur demonstrated that fermentation to produce alcohol is caused by
    8·1 answer
  • Match the element with its description. Match Term Definition Lithium A) Highly reactive gas Lead B) Nonreactive gas Fluorine C)
    12·1 answer
  • Compare and contrast the Bohr model of the atom with the modern model of the atom. What observations does the modern model expla
    5·2 answers
  • Find the difference 18/19 - 17/19<br> A. 2/19<br> B. 8/19<br> C. 1/19<br> D. 9/19
    10·1 answer
  • A 25.00 mL solution of 0.150 M NaCl is combined with 10.00 mL of a 0.0750 M CaCl2 solution. Assuming a total volume of 35.00 mL,
    7·1 answer
  • What color do we see when all light is reflected?
    6·1 answer
  • What is the role a species can assume in an ecosystem?
    14·1 answer
  • How are plastic containers and paper containers the same
    12·1 answer
  • What shows the substance at the highest temperature?
    14·2 answers
  • If you have a room that is 14 feet wide, 20.5 feet long, with 10 foot ceilings. What is the total
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!