1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
12

A laboratory technician drops a 0.0850 kg sample of unknown material, at a temperature of 100.0∘C, into a calorimeter. The calor

imeter can, initially at 19.0∘C, is made of 0.150 kg of copper and contains 0.200 kg of water. The final temperature of the calorimeter can is 26.1∘C.
Chemistry
1 answer:
GREYUIT [131]3 years ago
5 0

Answer:

1013.32 J/kg.K

Explanation:

The heat transferred by a changing in temperature without phase change can be calculated by:

Q = m*c*ΔT

Where m is the mass, c is the specific heat, and ΔT is the change in temperature (final - initial).

The values of c for water and copper can e found in thermodynamics tables:

cwater = 4.19x10³ J/kg.K

ccopper = 0.39x10³ J/kg.k

By the conservation of energy:

Qwater + Qcopper + Qmaterial = 0

0.200*4.19x10³*(26.1 - 19.0) + 0.150*0.39x10³*(26.1 - 19.0) + 0.085*c*(26.1 - 100) = 0

5949.8 + 415.35 - 6.2815c = 0

6.2815c = 6365.15

c = 1013.32 J/kg.K

You might be interested in
What is an oxidation state?
Oxana [17]

Answer:

Oxidation state shows the total number of electrons which have been removed from an element (a positive oxidation state) or added to an element (a negative oxidation state) to get to its present state

4 0
3 years ago
Picture attached, $3
Luba_88 [7]

Answer:

its -000.5

Explanation:

6 0
3 years ago
CO2(g) + H2O(I) - -> C6H12O6(s) + O2(g)
Lana71 [14]

Answer:

For instance equation C6H5C2H5 + O2 = C6H5OH + CO2 + H2O will not be balanced, but PhC2H5 + O2 = PhOH + CO2 + H2O will; Compound states [like (s) (aq) or (g)] are not required. If you do not know what products are enter reagents only and click 'Balance'. In many cases a complete equation will be suggested.

Explanation:

4 0
2 years ago
A woman weighing 450 Newtons sits on the floor. She exerts a force on the floor of
ANEK [815]

Answer: let me figure it out rlly quick

Explanation:

4 0
2 years ago
What is enthalpy?
aleksandrvk [35]

Answer: the heat content of a system at constant pressure.

Explanation:

Enthalpy is defined as the heat content of a system at constant pressure.

It is the heat absorbed or released during a reaction at constant pressure,denoted as ΔH.

7 0
3 years ago
Other questions:
  • While rowing in a race, John pulls the handle of an oar 0.80 m on each
    9·1 answer
  • A 5.0-gram sample of zinc and a 50.-milliliter sample of hydrochloric acid are used in a chemical reaction. Which combination of
    12·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • How many grams of iron metal do you expect to be produced when 305 grams of a 75.5 percent by mass iron(II) nitrate solution rea
    15·2 answers
  • ANSWER FAST PLEASE!<br> Balance the following equation:<br> __Hg + __O₂ --&gt; __HgO
    12·1 answer
  • 1.) Fluorite has a glassy luster and a white streak. It's an inorganic solid with a chemical formula of CaF2 CaF2
    15·2 answers
  • The only sure evidence for chemical reaction is
    5·2 answers
  • I need help with this can you help me?
    8·2 answers
  • What current (in a) is required to plate out 2. 96 g of nickel from a solution of ni2 in 27. 12 minutes?
    14·2 answers
  • Select the sentence from the section "Cute Beavers Also Cause Trouble" that is MOST important to include in the section's summar
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!