1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sauron [17]
3 years ago
15

A wooden boat discovered just south of the great pyramid in egypt has a carbon-14>carbon-12 ratio that is 72.5% of that found

in living organisms. how old is the boat
Chemistry
1 answer:
Kazeer [188]3 years ago
7 0
The half life for C14 is 5730 years.

We assume that Carbon 14/ Carbon 12 ratio was steady for living organisms over time, the problem is actually telling us that
\frac{Nt}{N0} = 0.0725 = \frac{1}{2}ˣ

Take the natural logarithm and In on both sides.
ln(0.725) = ln\frac{1}{2}ˣ
= - 0.3216 = xln (\frac{1}{2} = -0.6931x.
So x = (-.3216) / (-0.6931) = 0.464
or

t/t₁/₂ = 0.464
So t = 0.464 x t₁/₂ = 0.464 * 5730 yrs = 2660 years.
You might be interested in
What is called what a scientist personal opinion affects the way experimental results are reported?
e-lub [12.9K]
The answer would be A.Bias because the scientist can form a Bias opinion based on his beliefs 
3 0
4 years ago
Read 2 more answers
I need yall help with this one and i can make yall brilientist if u get it right plus yall get 50 points
mixas84 [53]

Answer:

D

Explanation:

6 0
3 years ago
Read 2 more answers
A stone is dropped from the roof of a building; 2.00s after that, a second stone is thrown straight down with an initial speed o
Brut [27]
A) -0.5(9.8)*t^2 = -25(t-2) - 0.5(9.8)(t-2)^2 
-4.9t^2 = -25t + 50 - 4.9(t^2-4t+4) 
0 = -25t+50+19.6t - 19.6 
5.4t = 30.4 
t = 5.62962963 s 

b) h = -4.9(5.62962963)^2 
h = -155.2943759 
the building is 155.2943759 m high 

c) speed 0of first stone 
= at 
= 9.8*5.62962963 
= 55.17037037 m/s 
speed of second stone
= v + at
= 25+9.8*3.62962963 
= 60.57037037 m/s
7 0
3 years ago
Which process involves an increase in entropy? crystallization of a solute from a solution ice melting into liquid water iodine
GrogVix [38]
Ice melting into liquid water.
7 0
3 years ago
Read 2 more answers
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
Other questions:
  • Which of the following does not affect the electrical resistance of a body?
    11·1 answer
  • If 2 objects have the same mass of 100 grams and object A has a volume of 50cm 3 and object B has a volume of 200 cm 3, which of
    15·1 answer
  • What mass of carbon dioxide gas occupies a volume of 81.3L at 204 kPa and a temperature of 95.0°C?
    14·1 answer
  • A brown solid<br> element conducts<br> electricity well. Is it a<br> metal or non-metal?
    9·2 answers
  • Which of the following is a characteristic of the antinides?
    14·1 answer
  • Please help I just need those last 4! :)
    15·1 answer
  • How many moles are in 45.8 g of calcium nitrate, Ca(NO3),?
    10·1 answer
  • What elements are most commonly used in wiring?
    15·1 answer
  • Fill in the blanks
    5·1 answer
  • What electrolyte may fall in level as a result of citrate toxicity from massive transfusion quizlket
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!