1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
5

What volume of 2.50 M Na2SO4 solution contains 71.0 grams of Na2SO4?

Chemistry
1 answer:
statuscvo [17]3 years ago
7 0

Answer

0.02

Explanation:

You might be interested in
Water that fills the cracks and spaces in underground soil and rock layers is calleda. salt water.
algol [13]
The answer is groundwater
8 0
3 years ago
Define the term inertia
n200080 [17]

Answer:

Explanation:

Enertia is an integral part of Newton's first law of motion.

It is the tendency of an object to <u>stay at rest</u> or <u>to continue moving</u> until and unless <u>any external unbalanced force</u>, (like, applied force or force of tension or frictional force ) is applied to either move it from rest or change its speed(in other words, accelerate it!!).

Example below, is of ball at rest (fig1) and if this ball is moving straight on a frictionless surface(like ice) it will keep moving!! until, we push it or pull it.

5 0
3 years ago
List at least two metric units that you used during the measurement activity to represent volume
Oliga [24]

Answer:

ml and cm3

Explanation:

millilitres and centimetres cubed or litres and metres cubed. Any unit of measuring liquid if the substance is a a liquid or a unit cubed

3 0
3 years ago
Cells that produce antibodies that help destroy the pathogens are called what
SOVA2 [1]
Antibodies are produced by a type of white blood cell called a plasma cell.
8 0
3 years ago
Read 2 more answers
Which scientist developed the first model of the atom that showed the structure of the inside of an atom
Eduardwww [97]

Answer:

Which scientist developed the first model of the atom that showed the structure of the inside of an atom

Ernest Rutherford

8 0
2 years ago
Other questions:
  • A scientist discovered a microscopic unicellular organism with no nucleus which of the following correctly describes the organis
    11·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which principles help geologists compare the timing of the origin of life forms and the timing of their extinction?
    13·2 answers
  • Which of the following best defines a scientific law?
    15·2 answers
  • For the neutralization reaction involving HNO3 and Ca(OH)2, how many liters of 1.55 M HNO3 are needed to react with 45.8 mL of a
    6·2 answers
  • Enter the net ionic equation for the reaction of aqueous sodium chloride with aqueous silver nitrate.
    11·2 answers
  • Does ice particles have high interparticle force of attraction? Justify your answer.<br> please and
    14·1 answer
  • How do the Carnivorous plants survive without soil?
    10·1 answer
  • How much food is wasted in the United States
    12·1 answer
  • 1 point
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!