What volume of 2.50 M Na2SO4 solution contains 71.0 grams of Na2SO4?

A mixture of iron and sulfur can be separated by A.magnetic attraction

Elenna [48]

A. Magnetic attraction

6 0

3 years ago

Reaction is

-Dominant- [34]

According to the task, you are proveded with patial pressure of CO2 and graphite, and here is complete solution for the task :
At first you have to find n1 =moles of CO2 and n2 which are moles of C
<span>The you go :
</span> $CO2(g) + C(s) \ \textless \ =\ \textgreater \ 2CO(g)$

n1 n2 0
-x -x +2x
$n1-x n2-x 2x Kp=P^2 (CO)/Pco2$
After that you have to use the formula $PV=nRT$
$Kp=(2x)^2/n1-x$
Then you have to solve x, and for that you have to use <span>RT/V
And to find total values:</span> $P(total)=n(total)*R*T/V$
I am absolutely sure that this would be helpful for you.

7 0

3 years ago

Do humans really have a third eye

Dominik [7]

Well I wouldn't quite call it a third eye but yes we have the ability to see things if we connect to our inner selves

6 0

3 years ago

Read 2 more answers

DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message

Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0

3 years ago

Identify which one of the three methods of analysis (i.e., TLC, IR and melting point) provides information about the structure o

Alex787 [66]

Answer:

IR provides structural information about a molecule. TLC and melting point analysis do not provide structural information.

Explanation:

IR gives information about the functional groups present in a molecule. The vibrational frequency of each functional group gives information about the structure of the entire molecule.

Structural features of a molecule are deduced by matching the vibrational frequencies of groups obtained from the IR spectroscopy with that of known functional groups in literature.

Melting point is a qualitative method that can only yield information about the identity of a compound and not its structure. Each compound has its unique melting point recorded in literature and any pure sample of the same compound must have the same sharp meting point.

Thin-layer chromatography (TLC) is a chromatography technique used to separate non-volatile mixtures. After separating the components of the mixture, it does not give any information regarding the identity or the structure of the components of the mixture.

Therefore, only IR yields structural information about a sample.

6 0

3 years ago