1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lyrx [107]
3 years ago
12

Why is glass brittle

Chemistry
1 answer:
WITCHER [35]3 years ago
6 0
Glass doesn't contain planes of atoms that can slip past each other, so there is no way to relieve stress. It has many microscopic cracks that act as seeds for fracture. It’s molecular structure is composed of tetrahedral crystals so it ruptured easily under stress
You might be interested in
What are 6 types of energies except Potential and Kinetic energy.
aivan3 [116]

Answer:

The different types of energy include thermal energy, radiant energy, chemical energy, nuclear energy, electrical energy, motion energy, sound energy, elastic energy and gravitational energy.

Explanation:

Hope this helps :D

7 0
3 years ago
Help me with this hw (homework)
Elan Coil [88]

Answer:

maison travaille

Explanation:

maison travaille

3 0
2 years ago
4. What are the characteristics of<br> the particles of matter?
mojhsa [17]

Not sure how in depth or what level of particles but I will go as deep as I know. The matter that makes up the world is comprised of 12 particles which are known as fermions. There are 12 fermions which are made up of 6 quarks (up, charm, top, Down, Strange, Bottom) 3 electrons (electron, muon, tau) and three neutrinos (e, muon, tau). Technically, only the up quark, down quark, electron, and electron neutrino are necessary to create all known matter since others would simply be very unstable and decay into those particles. The other type of particles are known as Bosons. These particles transmit forces and all sorts of different interactions. I have included a photo from online which describes the main characteristics of each elementary particle.

8 0
3 years ago
Will the composition of water molecules vary depending on their source?
Alecsey [184]

Answer:

It does not matter where the sample of water came from or how it was prepared. Its composition, like that of every other compound, is fixed.

6 0
2 years ago
What might a physicit choose to study?
AlekseyPX
Thermodynamics, Nuclear Physics, Quantum Physics, Astronomy and Astrophysics
7 0
3 years ago
Other questions:
  • What is the change of an atom of one element (atom) to an atom of different element called?
    7·2 answers
  • When nitrogen is removed from a sample of air by the process of nitrogen fixation, what happens to the total pressure of the sam
    5·1 answer
  • What is the average atomic mass (in amu) of element M?
    15·1 answer
  • Please help me:) thanks!
    12·2 answers
  • 0.080 mole ba, 0.080 mole s, and 0.320 mole o
    13·1 answer
  • The rate constant for a first-order reaction is 0.54 s-1. What is the half-life of this reaction if the initial concentration is
    6·1 answer
  • Charlie is doing a scientific investigation about the properties of light energy. For his experiment, he points a flashlight at
    13·2 answers
  • Which is a spectator ion in the reaction between KOH and CoBr2? CoBr2(aq) Co2+(aq) K+(aq) OH– (aq)?
    6·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Calculate the molarity of an HCl solution if 23.88 mL of it reacts with 6.5287 grams of sodium carbonate (106 g/mol) according t
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!