1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ladessa [460]
3 years ago
6

Metallic crystals are excellent conductors of electricity due to the existence of positive and negative ions.

Chemistry
2 answers:
Scorpion4ik [409]3 years ago
8 0

Metallic crystals are excellent conductors of electricity due to the existence of positive and negative ions.

TRUE

<u> FALSE</u>

My name is Ann [436]3 years ago
4 0

the answer is FALSE


You might be interested in
Orbitals which are equal in energy are referred to as ________.
mash [69]

Degenerate Orbitals

~ Meaning ~

Electron orbitals that have the same energy levels are called degenerate orbitals. When assigning electrons to orbitals in determining electron configurations, the Aufbau principle states that lower energy orbitals are filled before higher energy orbitals.

8 0
3 years ago
What is happening in the diagram? ​
OlgaM077 [116]

Answer:It is a picture with a boat sailing on the water with sound waves going down to an old and sunken ship but the waves then go back up to the boat in a different angle.

Explanation:

hope it works thx

4 0
4 years ago
Please help I need the answer by today and it is very important! Which of the following statements best describes why the mass o
Juliette [100K]

D, because matter does not change in space but unlike gravity, which changes, matter, is the mass of it, which will stay the same unless there is a chemical change or, physical change, but not in this case, so the answer you are looking for is D. hope this enlarged your understanding and knowledge.

6 0
3 years ago
Why do scientists establish boundaries for natural systems?
andrezito [222]

<>"The researchers stress that their approach does not offer a complete roadmap for sustainable development, but does provide an important element by identifying critical planetary boundaries. "Human pressure on the Earth system has reached a scale where abrupt global environmental change can no longer be excluded."<>

7 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • Will it give me the right answers
    11·1 answer
  • Question 7.7. All amino acids have a central carbon with four components attached to it. One of these components is called the R
    6·1 answer
  • In the modern periodic table, elements are arranged according to increasing ____. (1 point). . a. atomic number. b. atomic mass.
    8·1 answer
  • Which of the following statements is true?
    6·2 answers
  • You should only use your high-beam highlights when you are more than __________ feet behind another vehicle you are following.
    9·2 answers
  • Los campers ________ por un parque cerca del camping. Question options: dan una caminata se duermen toman una ducha
    9·1 answer
  • Which of the following measurements is equivalent to 5.461x10^-7m?
    13·1 answer
  • How many molecules of calcium chloride are in 3CaCl2
    13·1 answer
  • Why is the mitochondrion known as the "power house" of a cell?
    5·1 answer
  • How to separate crystals from solution​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!