1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
3 years ago
6

Identify the two main materials that can be found in the inner and outer core layers of the earth.

Chemistry
1 answer:
Mrrafil [7]3 years ago
6 0
A. Iron D. Nickel hope this helps you!
You might be interested in
Choose the reaction that represents the combustion of C6H12O2.
Leona [35]

Answer:

The answer to your question is:  letter D

Explanation:

In a combustion reaction, the reactants are always a molecule with Carbon that reacts with oxygen and the products are carbon dioxide and water.

According to the explanation, the only possible solution is:

a) C₆H₁₂O₂(l) ⇒ 6 C(s) + 6 H₂(g) + O₂(g)

b) Mg(s) + C₆H₁₂O₂(l) ⇒ MgC₆H₁₂O₂(aq)

c) 6 C(s) + 6 H₂(g) + O₂(g) ⇒ C₆H₁₂O₂(l)

d) C₆H₁₂O₂(l) + 8 O₂(g) ⇒ 6 CO₂(g) + 6 H₂O(g)

e) None of the above represent the combustion of C₆H₁₂O₂.

4 0
3 years ago
Read 2 more answers
What happens when a parking lot is built in a wetlands area?
Airida [17]
The ground could sink and sink holes could occur, otherwise the parking lot could simply break apart and wear faster
5 0
3 years ago
Read 2 more answers
How many grams of h2 are needed to produce 14.51 g of nh3?
gavmur [86]

Answer:

               2.57 g of H₂

Solution:

The Balance Chemical Equation is as follow,

                                          N₂  +  3 H₂    →    2 NH₃

According to Balance equation,

         34.06 g (2 moles) NH₃ is produced by  =  6.04 g (3 moles) of H₂

So,

               14.51 g of NH₃ will be produced by  =  X g of H₂

Solving for X,

                      X  =  (14.51 g × 6.04 g) ÷ 34.06 g

                     X =  2.57 g of H₂

7 0
3 years ago
Help............???????
balandron [24]

B. .175


Hope it helps!

4 0
2 years ago
Which of the following types of fossils is most commonly associated with wood?
DanielleElmas [232]
Petrified fossils, they are made of wood that becomes petrified from pressure and lack of oxygen.
5 0
3 years ago
Other questions:
  • Draw the molecules for the following reaction:
    14·1 answer
  • What is latice energy
    9·1 answer
  • A mixture of nacl and sucrose (c12h22o11) of combined mass 10.2 g is dissolved in enough water to make up a 250 ml solution. the
    15·1 answer
  • Which of the following elements would you expect to have the highest ionization energy value, and why?
    7·2 answers
  • How do you get bic grip permanent off of your hands?
    7·2 answers
  • Question is in picture! Due in 30 minutes!
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • When a lead storage battery discharges, the concentration of ___.
    13·1 answer
  • Need some help please?
    11·1 answer
  • Which describes the oxidizing agent in a chemical reaction?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!