1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
3 years ago
12

In the reaction below green chlorine gas and brown iodine chloride forms yellow iodine trichloride Cl2 (g) + ICl (l) ⇌ ICl3 (s)

If more iodine trichloride is added to the reaction, how will it affect the color of the mixture? A. It will become more brown and yellow B. It will become more green and brown C. It will become more yellow and green. D. It will not change.
Chemistry
1 answer:
Keith_Richards [23]3 years ago
6 0

Answer:

B. It will become more green and brown

Explanation:

Le Chateliers principle states that when a constraint such as change in concentration, volume, pressure or temperature is imposed on a reaction system at the equilibrium, the equilibrium position will shift in such a way as to annul the constraint. Let us see how this applies to the equation under consideration.

If the system is at equilibrium and more ICl3 is added to the system, the equilibrium will shift towards the left hand side (more reactants are formed). This implies that the colour of the system will become more green and brown since there are more reactants now in the system.

You might be interested in
Please help me out i don’t get this. what is the answers to 1-4.
VLD [36.1K]

Answer:

1. A circuit is a path that electricity flows along. It starts at a power source, like a battery, and flows through a wire to a light bulb or other object and back to other side of the power source.

2. A series circuit is one that has more than one resistor, but only one path through which the electricity (electrons) flows. All the components in a series circuit are connected end-to-end. A resistor in a circuit is anything that uses some of the power from the cell.

3. A parallel circuit is a circuit in which the electric current passes through two or more branches or connected parts at the same time before it combines again. Compare.

4. BOTH - 1. lightbulb 2. battery 3. switch

   SERIES- 1. Ammeter 2. voltmeter

i'm not sure about the rest sorry :(

7 0
3 years ago
How many moles are in 7.46 x 1025 particles of iron
sladkih [1.3K]

Answer:

1 mole of iron =6.023×10^23 particles

1 particles of iron=1/6.023×10^23 mole

7.46×10^25 particles =1/6.023×10^23×7.46×10^25

=1.238×10^48 mole is a required answer.

4 0
2 years ago
Calculate a pendulums frequency (in Hz) if the pendulum completes 19 cyclesin 0.5 s.
MAVERICK [17]
1Hz = 1 cycle per second

19 cycles / .5 seconds = 38Hz
8 0
3 years ago
If you have 23.8g of CaCl2, how many formula units is it?
NemiM [27]

Answer:

1.3×10²³ formula unit

Explanation:

Given data:

Mass of CaCl₂ = 23.8 g

Number of formula unit = ?

Solution:

Number of moles = mass/molar mass

Number of moles = 23.8 g/110.98 g/mol

Number of moles = 0.21 mol

1 mole of any substance contain 6.022×10²³ formula unit

0.21 mol × 6.022×10²³ formula unit / 1mol

1.3×10²³ formula unit

8 0
3 years ago
What is the electronegativity in the determination of the ionic or covalent character of a bond
Paladinen [302]

Polar Covalent is the name used to describe bonds that have both ionic and covalent character because the electrons are shared unequally. The Pauling Scale is used to assign electronegativity to atoms. It ranges from to 4.00 (fluorine).

8 0
3 years ago
Other questions:
  • A 52.0 mL volume of 0.25 M HBr is titrated with 0.50 M KOH. Calculate the pH after addition of 26.0 mL of KOH at 25 ∘C.
    14·1 answer
  • What adaptation might help a plant survive in an environment with cold winters?
    13·2 answers
  • What is the name of the high energy compound that cells use directly to fuel other chemical reactions?
    7·1 answer
  • PLEAEEEE HELPPP
    12·1 answer
  • What properties of matter explain why the weight of an object on the moon is different than the weight of the same object on ear
    8·1 answer
  • Is Kl covalent or ionic?
    6·1 answer
  • How many grams of H2O are in 3.00 moles of H2O?​
    15·1 answer
  • What volume of 6.67 mol of nacl congtains 3.12 mol of nacl
    11·1 answer
  • Calculate the molarity of a solution prepared by dissolving 13.0 g of Na2CrO4 in enough water to produce a solution with a volum
    14·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!