1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anuta_ua [19.1K]
3 years ago
8

Which would least strongly attract electrons from other atoms in a compound?

Chemistry
1 answer:
sergey [27]3 years ago
4 0
The concept we are looking for here is electronegativity. This concept is a measure of how strong an atom or element can attract a pair, that is bonding, of electrons to itself. 

Fluorine is the element or atom of the greatest electronegativity. Electronegativity would increase as we move left to right of the periodic table. 

 
You might be interested in
Find the volume of 20g of H₂ at STP<br><br>​
ANEK [815]

Answer:224

Explanation:

We should answer it with Stoichiometry

We say: 20 g H2× (1 mol/ 2g)× ( 22.4 lit/ 1 mol) = 224

Means: we have 20 grams and every 2g H2, equals to 1 mol of it and every 1 mol of H2, equals to 22.4 lit( because of STP)

hope you got this:)

6 0
3 years ago
Use the collision theory to explain how increasing the surface area of a solute will increase the rate of the dissolving process
Maksim231197 [3]
<span>More surface area --> more molecules of the solute in contact with the solvent --> more chance for a solvent molecule to collide with the solute molecules --> dissolves faster

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
5 0
3 years ago
Another carbon isotope has six protons and seven neutrons in its nucleus. What do you think this carbon isotope is called?
insens350 [35]

Answer:

Carbon - 13

Explanation:

For most of the elements other than that of hydrogen, the isotopes are named for the mass number.

Example : Carbon atoms with 6 neutrons have mass number of 12 ( as 6\ protons +6\ neutrons=12 ), so they are known as carbon-12.

Given that:

Protons = 6

Neutrons = 7

Mass = 6 + 7 = 13

So the name is Carbon - 13 . The symbol is ^{13}_{6}C

8 0
3 years ago
Read 2 more answers
Hi can u help me pls? I'm totally stuck . The natural source of acidity in rain water is _____.
kykrilka [37]

Answer-The correct option is option d with says all of the above.

Explanation- All three acids that are given combined together to form acid rain in which nitric and sulphuric acid are stronger acids present while carbonic acid is a weaker one.

The carbon dioxide admitted in air combines with water to form carbonic acid and gives a weak acidic nature to rainwater. Pollution in nature makes sulphur and nitrogen present in air react to form the stronger acids responsible for acid rain.

5 0
3 years ago
How many molecules are contained in 125 grams of water, H20?
sergejj [24]
Answer:

18,01528

Explanation:
8 0
3 years ago
Read 2 more answers
Other questions:
  • At 20 degrees celsius, how much sodium chloride could be dissolved in 2L of water
    5·1 answer
  • Area immediately surrounding a hazardous material incident which extends far enough to protect personnel outside the zone from c
    14·1 answer
  • Is sodium ion or sodium metal in table salt?
    14·1 answer
  • A student takes an object with an accepted mass of 120.0 grams and masses it on their
    10·1 answer
  • Do guitar strings deform? and how??
    13·1 answer
  • Which of the following elements is the most reactive?<br> A. Ba<br> B. Cs<br> C. Hf<br> D. Lu
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Determine the empirical formula of an oxide of iron, which has 69.9% iron and 30.1% dioxygen by mass.​
    9·1 answer
  • Where does fertilization occurs in human beings​
    8·2 answers
  • Approximately 50% of our bone is chemically calcium phosphate, Ca3(PO4)2
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!