1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
2 years ago
6

For the reaction 2N2O5(g) <---> 4NO2(g) + O2(g), the following data were colected:

Chemistry
1 answer:
KonstantinChe [14]2 years ago
3 0

Answer:

a) The reaction is first order, that is, order 1. Option C is correct.

b) The half life of the reaction is 23 minutes. Option B is correct

c) The initial rate of production of NO2 for this reaction is approximately = (3.7 × 10⁻⁴) M/min. Option has been cut off.

Explanation:

First of, we try to obtain the order of the reaction from the data provided.

t (minutes) [N2O5] (mol/L)

0 1.24x10-2

10 0.92x10-2

20 0.68x10-2

30 0.50x10-2

40 0.37x10-2

50 0.28x10-2

70 0.15x10-2

Using a trial and error mode, we try to obtain the order of the reaction. But let's define some terms.

C₀ = Initial concentration of the reactant

C = concentration of the reactant at any time.

k = rate constant

t = time since the reaction started

T(1/2) = half life

We Start from the first guess of zero order.

For a zero order reaction, the general equation is

C₀ - C = kt

k = (C₀ - C)/t

If the reaction is indeed a zero order reaction, the value of k we will obtain will be the same all through the set of data provided.

C₀ = 0.0124 M

At t = 10 minutes, C = 0.0092 M

k = (0.0124 - 0.0092)/10 = 0.00032 M/min

At t = 20 minutes, C = 0.0068 M

k = (0.0124 - 0.0068)/20 = 0.00028 M/min

At t = 30 minutes, C = 0.0050 M

k = (0.0124 - 0.005)/30 = 0.00024 M/min

It's evident the value of k isn't the same for the first 3 trials, hence, the reaction isn't a zero order reaction.

We try first order next, for first order reaction

In (C₀/C) = kt

k = [In (C₀/C)]/t

C₀ = 0.0124 M

At t = 10 minutes, C = 0.0092 M

k = [In (0.0124/0.0092)]/10 = 0.0298 /min

At t = 20 minutes, C = 0.0068 M

k = 0.030 /min

At t = 30 minutes, C = 0.0050 M

k = 0.0303

At t = 40 minutes

k = 0.0302 /min

At t = 50 minutes,

k = 0.0298 /min

At t = 60 minutes,

k = 0.031 /min

This shows that the reaction is indeed first order because all the answers obtained hover around the same value.

The rate constant to be taken will be the average of them all.

Average k = 0.0302 /min.

b) The half life of a first order reaction is related to the rate constant through this relation

T(1/2) = (In 2)/k

T(1/2) = (In 2)/0.0302

T(1/2) = 22.95 minutes = 23 minutes.

c) The initial rate of production of the product at the start of the reaction

Rate = kC (first order)

At the start of the reaction C = C₀ = 0.0124M and k = 0.0302 /min

Rate = 0.0302 × 0.0124 = 0.000374 M/min = (3.74 × 10⁻⁴) M/min

You might be interested in
Write a balanced equation for the combustion of C7H16(l) (heptane) -- i.e. its reaction with O2(g) forming the products CO2(g) a
JulsSmile [24]

Answer:

<u>The standard enthalpy of reaction = -4854.7kJ</u>

<u>The difference: </u>ΔH-ΔE = Δ(PV) = Δn.R.T = <u>9910.288 J ≈ 9.91 kJ</u>    

Explanation:

<u>The balanced chemical equation for the combustion of heptane</u>:

C₇H₁₆ (l) + 11 O₂ (g) → 7 CO₂ (g) + 8 H₂O (l)

Given: The standard enthalpy of formation (\Delta H _{f}^{\circ }) for: C₇H₁₆ (l) = -187.8 kJ/mol, O₂ (g) = 0 kJ/mol, CO₂ (g) = -393.5 kJ/mol, H₂O (l) = -286 kJ/mol

<u>To calculate the standard enthalpy of reaction (\Delta H _{r}^{\circ }) can be calculated by the Hess's law</u>:

\Delta H _{r}^{\circ } = \left [\sum \nu \cdot\Delta H _{f}^{\circ }(products)  \right ] - \left [\sum \nu\cdot\Delta H _{f}^{\circ }(reactants)  \right ]

Here, \nu is the stoichiometric coefficient

⇒ \Delta H _{r}^{\circ } =

\left [ 7\times \Delta H _{f}^{\circ }\left (CO_{2}\right )+ 8\times \Delta H _{f}^{\circ }\left (H_{2}O \right )\right ]

- \left [1\times \Delta H _{f}^{\circ }\left (C_{7}H_{16}\right ) +11\times \Delta H _{f}^{\circ }\left (O_{2} \right ) \right ]

=\left [ 7\times \left (-393.5 kJ/mol \right )+ 8\times \left (-286 kJ/mol \right )\right ]

-\left [1\times \left (-187.8 kJ/mol \right ) +11\times \left (0 kJ/mol \right ) \right ]

⇒ \Delta H _{r}^{\circ } = \left [ \left (-2754.5 \right )+ \left (-2288 \right )\right ]\left -[ \left (-187.8 \right ) +\left (0 \right )\right ]

⇒ \Delta H _{r}^{\circ } = \left [ -5042.5 ]\left -[ -187.8] = \left ( -4854.7kJ \right )

<u>To calculate the difference: </u>ΔH-ΔE=Δ(PV)

We use the ideal gas equation: P.V = n.R.T

⇒ ΔH-ΔE=Δ(PV) = Δn.R.T

Given: Temperature:T = 298K, R = 8.314 J⋅K⁻¹⋅mol⁻¹

Δn = number of moles of gaseous products - number of moles of gaseous reactants = (7)- (11) = (-4)

⇒ ΔH-ΔE=Δ(PV) = Δn.R.T = (-4 mol) × (8.314 J⋅K⁻¹⋅mol⁻¹) × (298K) = <u>9910.288 J = 9.91 kJ</u>                              (∵ 1 kJ = 1000J )

                                                                             

8 0
3 years ago
How many types of hybridization does carbon undergo?​
Novosadov [1.4K]

Answer:

For carbon the most important forms of hybridization are the sp2- and sp3- hybridization. Besides these structures there are more possiblities to mix dif- ferent molecular orbitals to a hybrid orbital. An important one is the sp- hybridization, where one s- and one p-orbital are mixed together.

3 0
2 years ago
The burning characteristics of a gasoline can be improved by converting the octane it contains into isooctane. This conversion r
bogdanovich [222]

Gasoline is refined petroleum used in engines as a fuel. It contains octane that can be converted to isooctane by adding catalysts like platinum and palladium.

<h3>What are catalysts?</h3>

Catalysts are substances that raise the reaction rate by decreasing the activation energy but do not get consumed themselves in a reaction.

Platinum and palladium metals can be used as a catalyst to convert the octane of the gasoline into isooctane as they are oxidation catalyst that converts the fuel components into water and carbon dioxide.

Therefore, platinum and palladium are used as catalysts in converting octane.

Learn more about catalysts here:

brainly.com/question/1392595

#SPJ4

7 0
8 months ago
Which spectroscopic tool would be best for distinguishing a sample of 1,2,2-tribromopropane from 1,1,2-tribromopropane?
12345 [234]

1-H NMR spectroscopy tool will be used for distinguishing a sample of 1,2,2-tribromopropane from 1,1,2-tribromopropane.

The preferred method for determining or validating the structure of organic molecules or those containing protons is H NMR. When compared to other nuclei, a solution-state proton spectrum may be obtained relatively quickly, and it contains a wealth of knowledge regarding a compound's structure.

It can be calculated by simply counting the number of unique hydrogens on one side of the symmetry plane will give you the count of signals individual molecules emit in a 1H NMR spectrum.

Therefore, 1-H NMR spectroscopy tool will be used for distinguishing a sample of 1,2,2-tribromopropane from 1,1,2-tribromopropane.

To know more about 1-H NMR spectroscopy

brainly.com/question/20111886

#SPJ4

5 0
1 year ago
What is the mass of 7.50 moles of magnesium chloride, mgcl2?
Natali5045456 [20]
MgCl2 = 1Mg + 2Cl = 1(24.3) + 2(35.45) = 95.2g/1mole
7.50moles MgCl2 x 95.2g MgCl2 = 714g MgCl2
8 0
3 years ago
Other questions:
  • When aqueous solutions of ________ are mixed, a precipitate forms.
    10·1 answer
  • What is the empirical formula of a molecule containing 65.5% carbon, 5.5% hydrogen, and 29.0% oxygen?
    5·1 answer
  • What is the kind of energy that occurs when nuclear bonds split or fuse?
    6·1 answer
  • Which equation represents the combined gas law?
    14·2 answers
  • The function of hydrochloric acid in the gastric juice.
    6·1 answer
  • Which of the following is a norm or value that sports may socialize children about
    6·1 answer
  • Balance Cr2O3+Mg --&gt;Cr + MgO
    8·1 answer
  • Solid zinc oxide (ZnO) is added to hydrochloric acid (HCl) to form zinc chloride (ZnCl2) in water (H2O). How many moles of zinc
    9·1 answer
  • How much energy is required to vaporize 2 kg of gold? Use the table below
    6·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!