1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
puteri [66]
3 years ago
10

We sprayed the flowers with water. They did not turn pink.

Chemistry
1 answer:
Gennadij [26K]3 years ago
3 0

Answer:

g

Explanation:

You might be interested in
What volume of a 3.0 M stock solution of H2SO4 is needed to prepare 2.8 L of a 1.6 M H2SO4 solution?
Georgia [21]
Use M1V1 = M2V2 to solve
3(V1) = 2.8 * 1.6
3(V1) = 4.48
V1 = 1.493 L of stock solution
4 0
3 years ago
Read 2 more answers
Which of the following coefficients are needed to balance the combustion reaction of ethanol?
djyliett [7]
Answer is: d. 3,2,3.

Balanced chemical reaction: CH₃CH₂OH + 3O₂ → 2CO₂ + 3H₂O.
CH₃CH₂OH is ethanol.
O₂ is molecule of oxygen.
CO₂ is carbon(IV) oxide.
H₂O is water.
There are same number of atoms (oxygen, carbon and hydrogen) on both side of balanced chemical reaction:
2 atoms of carbon.
6 atoms of hydrogen.
7 atoms of oxygen.



5 0
3 years ago
What mass of powdered drink mix is needed to make a 0.5 M solution of 100 mL?
Maru [420]

Answer:

There is 17,114825 g of powdered drink mix needed

Explanation:

<u>Step 1 :</u> Calculate moles

As given, the concentration of the drink is 0.5 M, this means 0.5 mol / L

Since the volume is 100mL, we have to convert the concentration,

⇒0.5 / 1   =  x /0.1    ⇒ 0.5* 0.1  = x = 0.05 M

This means there is 0.05 mol per 100mL

e

<u>Step 2 </u>: calculate mass of the powdered drink

here we use the formula n (mole) = m(mass) / M (Molar mass)

⇒ since powdered drink mix is usually made of sucrose (C12H22O11) and has a molar mass of 342.2965 g/mol.

0.05 mol = mass / 342.2965 g/mol

To find the mass, we isolate it ⇒0.05 mol * 342.2965 g/mol = 17,114825g

There is 17,114825 g of powdered drink mix needed

3 0
3 years ago
Read 2 more answers
There are many compounds that contribute to the overall aroma of a banana. The primary compound is called isoamyl acetate and co
Murljashka [212]

Explanation:

Let the mass of isoamyl acetate be 100g.

Moles of Carbon = 60.58/12 = 5.048mol

Moles of Hydrogen = 7.07/1 = 7.07mol

Moles of Oxygen = 32.28/16 = 2.018mol

Mole Ratio of C : H : O

= 5.048 : 7.07 : 2.018

= 5 : 7 : 2.

Hence the empirical formula of isoamyl acetate is C5H7O2.

8 0
3 years ago
List the path of the respiratory system
Lena [83]
nasal cavities (or oral cavity) > pharynx > trachea > primary bronchi (right & left) > secondary bronchi > tertiary bronchi > bronchioles > alveoli (site of gas exchange)
3 0
4 years ago
Other questions:
  • Asap, I need help
    15·2 answers
  • The tarnish that forms on objects made of silver is solid silver sulphide. This can be removed by reacting it with aluminium met
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • To isolate the benzoic acid from the bicarbonate solution, you should
    7·1 answer
  • Minerals are classified according to their Question 20 options: origin. specific gravity. color. composition.
    7·1 answer
  • What type of atoms will end up with a negative charge?
    6·2 answers
  • 50 One beneficial use of radioisotopes is(1) detection of disease
    5·1 answer
  • What type of eclipse is pictured below?
    5·1 answer
  • Calculate the energy of the lasers in a Blu-ray player, which emit at a wavelength of 4.05x10−7 m.
    13·1 answer
  • PLeas hurry
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!