1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
15

The theory of continental drift was widely unaccepted until scientists started using ________ the map the ocean floor.

Chemistry
2 answers:
anygoal [31]3 years ago
8 0

Answer:

B Sonar

Explanation:

Bumek [7]3 years ago
4 0

Answer:

B. SONAR (Sound Navigation Ranging)

Explanation:

Just took the test

You might be interested in
Creating nuclear energy produces large amounts of radioactive waste.
Montano1993 [528]
Ummmm this one is hard but i guess it would be t?????

7 0
2 years ago
PLEASE HELP MEEE!!!!
Assoli18 [71]
It would be 35.8 Calories or calories. Not sure about that part. Hope this helps though.
3 0
3 years ago
Poor precision in scientific measurement may arise from
Arturiano [62]
<span>Based on the experience of the responder, to correctly calculate measurements in real-world. Firstly is to avoid errors as much as possible. Errors are what makes your measurement invalid and unreliable. There are two types of error which is called the systematic error and the random error. Each error has different sources. Words that were mentioned –invalid and unreliable are very important key aspects to determine that your measure is truly accurate and consistent. Some would recommend using the mean method, doing three trials in measuring and getting their mean, in response to this problem.</span>
7 0
3 years ago
What is true about ionic compounds?
bezimeni [28]
It’s D I am pretty sure.
6 0
3 years ago
Balance the following reaction. 2Ca3(PO4)2 + C + 6SiO2 → CaSiO3 + P4 + CO
miskamm [114]

Answer:

2Ca₃(PO₄)₂ + 10C + 6SiO₂ → 6CaSiO₃ + P₄ + 10CO.

Explanation:

  • To balance a chemical reaction, we should apply the law of conservation of mass.

  • Law of conversation of mass states that the no. of atoms is equal in both sides of the chemical reaction.

  • So, the balanced chemical reaction is:

<em>2Ca₃(PO₄)₂ + 10C + 6SiO₂ → 6CaSiO₃ + P₄ + 10CO.</em>

that 2 mol of Ca₃(PO₄)₂ react with 10 mol of C and  6 mol of SiO₂ to produce 6 mol of CaSiO₃, 1 mol of P₄ and 10 mol of CO.

3 0
3 years ago
Read 2 more answers
Other questions:
  • By which process is a precipitate most easily separated from the liquid in which it is suspended
    5·2 answers
  • carbon disulfide is formed by the reaction of coke (carbon) with sulfur dioxide. how many moles of cs2 will be generated if 8.0
    14·1 answer
  • In the covalent bond formation process orbitals from each atom overlap and electrons are shared between each atom. You can visua
    5·1 answer
  • What is the first law of thermodynamics also known as?
    6·1 answer
  • If you have 1kg of carbon and 1 kg of gold, they will weigh the same.
    5·1 answer
  • How many moles of ammonia gas occupy 50 mL at at 700 kPa and 30.0 0C?
    9·1 answer
  • Indicate the charge the following elements as they achieve the noble gas configuration.
    15·1 answer
  • How many moles are in 29.8grams of CaCl2?
    8·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Determine the number of moles of hydrogen atoms in each sample.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!