1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
3 years ago
10

What is the amount of moles for 12.0 g Ar?

Chemistry
2 answers:
Digiron [165]3 years ago
8 0

if i am correct it shall be 12. because i am thinking, 1 mole = 1 ar.

Ainat [17]3 years ago
4 0

Answer:

1 mole is equal to 1 moles Argon, or 39.948 grams

Explanation:

You might be interested in
Heat energy is transferred on Earth by the processes of convection, conduction, and radiation. How does heat energy cause materi
lana66690 [7]
I think it will be D or B but my mine answer is D
5 0
3 years ago
Which statement correctly describes the relationship between air temperature and air pressure?
grigory [225]

Answer:

-Warm air sinks, creating an area of low pressure.

Explanation:

Heat will weigh more, than cool air!

7 0
3 years ago
PLZ HURRY
Aliun [14]

Hello.

The answer is: False

The current theory of the formation of our solar system is that the planets formed more or less in their present orbits and they were made balls of gas but they were never comets captured by the sun.

Have a nice day

5 0
3 years ago
Read 2 more answers
Which element in the third period would you expect to have the larger atomic radius, sodium (Na) or Sulfur
miskamm [114]
Sodium will have a larger radius. Look up the atomic radius Trend
4 0
3 years ago
Describe the structure of a typical metal such as iron ?<br>assaaap
dimaraw [331]

Answer:

Metals consist of giant structures of atoms arranged in a regular pattern. The electrons from the outer shells of the metal atoms are delocalised , and are free to move through the whole structure. This sharing of delocalised electrons results in strong metallic bonding .

Explanation:

mark me as brainliest

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which substance is a gas at 20˚C and one atmosphere of pressure? A. C B. O3 C. Ca D. I2
    13·1 answer
  • How many atoms are in 131.97 liters of water vapor at STP?
    11·1 answer
  • It takes 208.4 kJ of energy to remove 1 mole of electrons from 1 mole of atoms on the surface of rubidium metal. How much energy
    15·1 answer
  • For the equilibrium: 2 NO (g) &lt;----&gt; N2(g) + O2 (g), Kp=2400. If initially, only NO is present at a partial pressure o
    14·2 answers
  • Electric lights will not come on unless their electrical circuit is a?
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Is the answer B? Help
    7·1 answer
  • Helppppppp meeeeeeeeeeeee
    11·2 answers
  • The end result of ecological succession is called?
    5·1 answer
  • The actual density of iron is 7.874 g/mL. In a laboratory investigation, Jason finds the density of a piece of iron to be 7.921
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!