1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxMikexx [17]
3 years ago
6

what is it called when a scientists personal opinion affects the way experimental results are reported?

Chemistry
2 answers:
olganol [36]3 years ago
7 0

<span>Step 1. Make observations. These observations should be objective, not subjective. In other words, the observations should be capable of verification by other scientists. Subjective observations, which are based on personal opinions and beliefs, are not in the realm of science. Here’s an objective statement: It is 58 °F in this room. Here’s a subjective statement: It is cool in this room.</span>

<span>
</span>
Monica [59]3 years ago
4 0

I believe the word that you are looking for is "subjective"

-to be influenced by personal opinion or feeling-

PLEASE RATE AS THE BRAINLIEST ANSWER! THANK YOU! :)

You might be interested in
What passes through the Haversian canal
Tamiku [17]

A Haversian canal is referred to as any minute tube, which forms a network in a bone and also contains blood vessels. Blood vessels, nerve fibers and lymphatics may pass through the Haversian canal. Haversian canals are found surrounding blood vessels and nerve cells all over the bones and interacts with bone cells from end to end networks known as canaliculi.

4 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Many enjoys the warm waters of a ______.
nadya68 [22]

Answer:

hot spring

Explanation:

The mineral water in hot springs can also help reduce stress by relaxing tense muscles. Meanwhile as your body temperature rises in the bath, and then cools once you exit can also help you relax and fall into a deeper sleep.

6 0
3 years ago
What is the hydrogen ion (H+) concentration of a solution of pH 8?
fgiga [73]

Answer:

10−8 M.

Explanation:

In this problem we are given pH and asked to solve for the hydrogen ion concentration. Using the equation, pH = − log [H+] , we can solve for [H+] as,

− pH = log [H+] ,

[H+] = 10−pH,

by exponentiating both sides with base 10 to "undo" the common logarithm. The hydrogen ion concentration of blood with pH 7.4 is,

[H+] = 10−7.4 ≈ 0.0000040 = 4.0 × In this problem we are given pH and asked to solve for the hydrogen ion concentration. Using the equation, pH = − log [H+] , we can solve for [H+] as,

− pH = log [H+] ,

[H+] = 10−pH,

by exponentiating both sides with base 10 to "undo" the common logarithm. The hydrogen ion concentration of blood with pH 7.4 is,

[H+] = 10−7.4 ≈ 0.0000040 = 4.0 × 10−8 M.

3 0
3 years ago
Read 2 more answers
What are the parts of the water system? Label the water wheel to show the matter and forms energy that flow through the system.
Irina-Kira [14]

Answer:

Source, processing and distribution are the components of water system.

Explanation:

There are three parts of water system i. e. the source, the processing and distribution. Water is extracted from a source such as underground water, lake or river etc. After extraction this water is transported to the processing unit where it can be purified and after purification it is distributed to all places where it is needed. Potential energy is a form of energy that flows through this water system because the water is extracted from a depth and we know that depth and height refers to potential energy.

8 0
3 years ago
Other questions:
  • The density of solid aluminum is 2.70 . If a 1g peice of aluminum is dropped in a cup of water, it will . (The density of water
    14·1 answer
  • Be sure to answer all parts.The equilibrium constant (Kc) for the formation of nitrosyl chloride, an orange-yellow compound, fro
    7·1 answer
  • What is the number of molecules in 500cm? of oxygen under room conditions?
    13·1 answer
  • What is the concentration (M) of CH3OH in a solution prepared by dissolving 12.5 g of CH3OH in sufficient water to give exactly
    12·1 answer
  • Choose the aqueous solution below with the highest freezing point. These are all solutions of nonvolatile solutes and you should
    9·1 answer
  • Identify two factors that can make climates vary from place to place
    13·2 answers
  • Find the pH of a 0.0015 M HCl solution
    12·1 answer
  • 2FeO(s) ⇌ 2Fe(s) + O2(g) K eq = 1 x 10^-6 at 1000 K
    9·1 answer
  • Does anyone want to do stoichiometry? <br> im so tired of chemistry.
    13·2 answers
  • What are the characteristics of nonvascular plants? (select all that apply) A . They don’t rely on roots to receive water.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!