Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
**Visible confusion** no problem
Answer: 22g of chlorine would be needed to carry out this synthesis reaction
Explanation:
A synthesis reaction is one in which two or more than two elements combine together to forma single product.
The atoms present in the reactants are found on the product side. According to the law of conservation of mass, the number of atoms on both sides of the arrow must be same as the total mass must be conserved.
15 grams of sodium reacts with 22 grams of chlorine to yield 37 grams of sodium chloride. Thus 22g of chlorine would be needed to carry out this synthesis reaction.
Answer : The value of rate of reaction is 
Explanation :
Rate law : It is defined as the expression which expresses the rate of the reaction in terms of molar concentration of the reactants with each term raised to the power their stoichiometric coefficient of that reactant in the balanced chemical equation.
The given chemical equation is:
Rate law expression for the reaction is:
![\text{Rate}=k[NO]^a[O_2]^b](https://tex.z-dn.net/?f=%5Ctext%7BRate%7D%3Dk%5BNO%5D%5Ea%5BO_2%5D%5Eb)
As per question,
a = order with respect to 
= 2
b = order with respect to 
= 1
Thus, the rate law becomes:
![\text{Rate}=k[NO]^2[O_2]^1](https://tex.z-dn.net/?f=%5Ctext%7BRate%7D%3Dk%5BNO%5D%5E2%5BO_2%5D%5E1)
Now, calculating the value of rate of reaction by using the rate law expression.
Given :
k = rate constant = 
[NO] = concentration of NO = 
![[O_2]](https://tex.z-dn.net/?f=%5BO_2%5D)
= concentration of = 
Now put all the given values in the above expression, we get:
Hence, the value of rate of reaction is
25 drops of acid is required to neutralize the 50.0 ml of 0.010m of NaOH in the experiment.
The equation of the reaction is;
NaOH(aq) + HCl(aq) ---------> NaCl(aq) + H2O(l)
We can use the titration formula;
CAVA/CBVB = NA/NB
CA= concentration of acid
VA = volume of acid
CB = concentration of base
VB = volume of base
NA = number of moles of acid
NB = number of moles of base
CB = 0.010 M
VB = 50.0 ml
CA = 0.50 M
VA = ?
NA = 1
NB = 1
Substituting values;
CAVANB = CBVBNA
VA = 0.010 × 50.0 × 1/ 0.50 × 1
VA = 1 ml
Since the total volume of acid used is 1 ml and each drop contains 0.040 ml
The number of drops required is 1ml/0.040 ml = 25 drops
Learn more: brainly.com/question/1527403
