1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fed [463]
3 years ago
14

7.32 moles of hydrogen reacts with 48.97 grams of nitrogen, how many moles of ammonia is produced?

Chemistry
1 answer:
faust18 [17]3 years ago
7 0

3.5 moles of ammonia (NH₃) are produced

Explanation:

We have the following chemical reaction where hydrogen (H₂) reacts with nitrogen (N₂) to produce ammonia (NH₃):

3 H₂ + N₂ → 2 NH₃

number of moles = mass / molecular weight

number of moles of N₂ = 48.97 / 28 = 1.75 moles

We see from the chemical reaction that 1 mole of N₂ will react with 3 moles of H₂, so 1.75 moles of nitrogen will react with 3 × 1.75 = 5.25 moles of H₂. We have 7.32 moles of H₂, a quantity more of what is needed, so the limiting reactant is N₂.

Knowing this we devise the following reasoning:

if         1 mole of N₂ produces 2 moles of NH₃

then   1.75 moles of N₂ produces X moles of NH₃

X = (1.75 × 2) / 1 = 3.5 moles of NH₃

Learn more about:

limiting reactant

brainly.com/question/7144022

#learnwithBrainly

You might be interested in
The sum of the number of proteins and neutrons in an atoms nucleus is its __________ ___________.
otez555 [7]

Answer:

Mass Number

Explanation:

In nuclear physics, the sum of the numbers of protons and neutrons present in the nucleus of an atom.

Please vote brainliest!

8 0
2 years ago
Read 2 more answers
Suppose Highlinium-308 can also undergo positron emission
____ [38]

Answer:

The atomic number of burienium will be 307.

Explanation:

During positron emission proton is converted into the neutron and one electron neutrino with positron is released. It means the atomic number will be reduce by one and atomic mass remain same.

For example:

²³Mg₁₂    →     ₁₁Na²³+ e⁺+ Ve

Similarly, when highlinium-308 undergoes positron emission the new element burienium is produced and the atomic number will be 307 while atomic mass remain same.

Properties of beta radiations:

Beta radiations are result from the beta decay in which electron is ejected. The neutron inside of the nucleus converted into the proton an thus emit the electron which is called β particle.

The mass of beta particle is smaller than the alpha particles.

They can travel in air in few meter distance.

These radiations can penetrate into the human skin.

The sheet of aluminium is used to block the beta radiation

4 0
3 years ago
If 50.75 g of a gas occupies 10.0 l at stp, 129.3 g of the gas will occupy __________ l at stp.
Rom4ik [11]
Use PV = mRT/M and solve for R. R = PVM/RT. Since you have the same gas under two sets of conditions then you can write 
<span>P1V1M1/m1T1 = P2V2M2/m2T2 </span>
<span>Since P, M and T are constant, the equation becomes </span>
<span>V1/m1 = V2/m2 </span>
<span>Now plug in your values and solve for V2</span>
6 0
3 years ago
Read 2 more answers
Why does oxygen have a melting point
Jlenok [28]

Answer:

The intermolecular forces between water molecules are stronger than those between oxygen molecules. In general, the bigger the molecule, the stronger the intermolecular forces, so the higher the melting and boiling points.

5 0
2 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • The radioactive isotope z has a half-life of 12 hours. after 2 days, the fraction of the original amount remaining is
    12·1 answer
  • What mass is needed for 5000 moles of iron.
    8·1 answer
  • Earth is in a habitable zone that allows our planet to have liquid water. What is this zone called?
    5·2 answers
  • Can somebody plz answer a.b.c (just make it 1 sentence for each)
    6·2 answers
  • Both isopropyl alcohol, C3H8OH, and ethylene glycol, C2H6O2, are used as antifreeze. When equal masses of each are added to wate
    8·2 answers
  • In general, both cations and anions will __________ as you go down a group.
    14·1 answer
  • Dissolved hydrofluoric acid reacts with dissolved sodium hydroxide to form water and aqueous sodium fluoride
    12·1 answer
  • Can you please help me with this question
    7·1 answer
  • A screw is an example of a modified 1 pulley 2 Wedge 3 inclined plane 4 wheel​
    14·1 answer
  • What can you conclude about the relationship between height and energy?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!