1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena-14-01-66 [18.8K]
3 years ago
9

A drop of gasoline has a mass of 22 mg and a density of 0.754 g/cm3. What is its volume in cubic centimeters?

Chemistry
1 answer:
ArbitrLikvidat [17]3 years ago
5 0
1.22 mg is the same as .022 grams. One gram equals 1000 mg. Convert mg to grams  by dividing mg by 1000mg/gm. Volume = mass over density. Volume equals .022 grams over .754 grams/cm3 which equals .029 or .03cm3. 2.weight in kg times gravity constant. Weight in newtons equals 10kg times 9.8m/s2 that equals 98 newtons. 
You might be interested in
What resources are sometimes shared by squirrels and certain birds answer quick I need to get to the bus stop!!
Colt1911 [192]

Answer:

I know someone that has the answer

Explanation:

I know someone that has the answer

7 0
3 years ago
2.5 moles of sodium chloride is dissolved to make 0.050 liters of solution
Hitman42 [59]

The answer is:

the molarity = 50 moles/liters

The explanation:

when the molarity is = the number of moles / volume per liters.

and when the number of moles =2.5 moles

and the volume per liters = 0.05 L

so by substitution:

the molarity = 2.5moles/0.05L

                    = 50 moles /L

7 0
3 years ago
My teacher is grading this soon can someone help me ASAP!
Stolb23 [73]

10. You demonstrated the difference in density of the two objects. It is a physical property.

11. First calculate the density for all of them: density = mass/volume

Density:

A. 5/6 g/ml

B. 10/9 g/ml

C. 15/16 g/ml

D. 20/10 g/ml

If the density of the substance is higher than the density of the substance it is put in, then it will sink. So substances B and D will sink in water, as their densities are higher than 1 g/ml.

12. Ammonia weighs less than water does-- for example, the weight of 8 gallons of ammonia will be equivalent to the weight of 5 gallons of water.

Hope this helped!

3 0
3 years ago
In the following equation, which element has been reduced?
Mila [183]
The answer is A. you sre correct!
4 0
3 years ago
The __________ system is made up of the nose, pharynx, trachea, lungs, bronchi, and alveoli. *
Reil [10]
Respiratory system is made of that
4 0
3 years ago
Read 2 more answers
Other questions:
  • Does everything that you can see fit the definition for matter
    5·1 answer
  • Choose all the right answers.
    7·1 answer
  • What is the difference between a molecule name and a chemical formula?
    8·1 answer
  • The energy exchange with the environment during a chemical reaction is called the heat of reaction.
    14·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is due to acid formed when atmospheric and volcanic gases mix in water pizzazz helpp​
    7·1 answer
  • Check out this long-form version of the periodic table. It shows where the two rows of
    15·1 answer
  • What is the total number of electrons in As-3?
    12·1 answer
  • 2. What happens when hydrochloric acid (HCl) is added to the solution? Do the relative concentrations of H+, CH3COOH, or
    12·2 answers
  • Neutrons are very important to an atom's ________<br> properties
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!