1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
3 years ago
11

A ruptured tank in Anywhere, USA, spilled hydrochloric acid. Officials were reported to be concerned that the acid might mix wit

h sodium hydroxide (caustic soda) in a neighboring tank and form a toxic gas. What toxic gas would be formed by mixing hydrochloric acid with sodium hydroxide? 1. chlorine 2. carbon dioxide 3. None 4. chlorine dioxide
Chemistry
1 answer:
lawyer [7]3 years ago
5 0

Answer:

Option C; NONE.

Explanation:

A chemical reaction forms new chemicals called the products from the initial chemicals called the reactants. The reaction between an acid and a base is called neutralization, and the products formed are water and a salt.

When hy­drochlo­ric acid and sodi­um hy­drox­ide is mixed together, they in­ter­act, and re­sult­ in salt and a release of heat.

The re­sult of the in­ter­ac­tion of these two high­ly ag­gres­sive com­pounds is ta­ble salt and wa­ter, these resulting com­pounds are ul­ti­mate­ly harm­less, and even ben­e­fi­cial, to hu­man be­ings.

Therefore, NO TOXIC GAS WOULD BE FORMED BY MIXING HYDROCHLORIC ACID WITH SODIUM HYDROXIDE.

You might be interested in
Can someone help me out with this?
ycow [4]

Answer:

2.8 * 10^(-6) / 1.4 * 10^(-2)=

2* 10^(-8)

4 0
4 years ago
212 pb 82 is the isotope notation for iron. what is the atomic number, mass number, and number of both protons and neutrons?
o-na [289]

Hello!

The mass number in isotope notation is denoted A, the atomic number is denoted as Z, and the element is denoted as X.

In the given isotope, the mass of the isotope is 212 amu, and the atomic number is 82.

We know that the number of electrons, and protons are equal to the atomic number. Therefore, there are 82 protons. Also, to find the number of neutrons, we subtract the atomic number from the atomic mass.

212 - 82 = 130 neutrons

<u>Final answers</u>:  

  1. Atomic Number: 82
  2. Mass number: 212
  3. Number of Protons: 82
  4. Number of Neutrons: 130
5 0
3 years ago
When co2 levels are low and o2 levels are high, rubisco adds an o2 molecule to rubp. what are the consequences of this reaction?
marissa [1.9K]
Rubisco is an important enzyme that helps in making lifeless carbon of carbon dioxide into organic molecules. Rubisco takes carbon dioxide and attaches it to ribulose bisphosphate, a short sugar chain with five carbon atoms that has rubp as its shortcut. Rubisco then clips the lengthened chain into to polyglycerate pices, which are pretty flexible molecules and are also used in the feeding of the plant. Most of it is used in the photosynthesis pathway, but some of it is used to make sucrose (table sugar) to feed the rest of the plant, or stored away in the form of starch for later use. Hence, rubisco is crucial in the storing of the energy that is created from photosynthesis.


4 0
3 years ago
Measurements show that unknown compound X has the following composition: element mass % carbon 41.0% hydrogen 4.58% oxygen 54.6%
anastassius [24]

Answer:

CHO

Explanation:

Carbon = 41%,  Hydrogen = 4.58%, oxygen = 54.6%

Step 1:

Divide through by their respective relative atomic masses

41/ 12,         4.58/1,         54.6/16

3.41              4.58            3.41

Step 2:

Divide by the lowest ratio:

3.41/3.41,      4.58/3.41,     3.41/3.41

1,                    1,                  1

Hence the empirical formula is CHO

8 0
3 years ago
What is the significance of wanting to know what the pH of a solution is?
balu736 [363]

pH is an important parameter for many reactions to take place in solution and in biological systems. It is related to the concentration of H⁺ ions through the following expression:

pH = 1/[H⁺] = -log [H⁺]

Wanting to know the pH of a solution is equivalent to knowing the amount of hydrogen ions present. But the pH scale is more convenient than the concentration scale because pH usually takes values between 0 and 14.

  • When pH < 7 the solution is acid.
  • When pH = 7 the solution is neutral (like pure water).
  • When pH > 7 the solution is basic.
4 0
3 years ago
Other questions:
  • What happens to the gibbs free energy term when a chemical reaction is reversed?
    7·1 answer
  • A gas effuses 4.0 times faster than oxygen (O2). What is the molecular mass of the gas?
    14·1 answer
  • What is si atomic radius
    15·1 answer
  • Stellar fusion produces atoms up to and including ___________ Question 51 options: Helium (atomic number 2) Carbon (atomic numbe
    10·1 answer
  • During a reaction, a halogen chemically combines with a Group 1 element to form a compound. how does this reaction occur, based
    6·2 answers
  • How many grams of iron metal do you expect to be produced when 325 grams of an 87.5 percent by mass iron (II) nitrate solution r
    10·1 answer
  • Individuals within populations exhibit some diversity. As a result of possessing slightly different traits, some individuals are
    12·2 answers
  • Is hot tea homogeneous or heterogeneous?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Rolls of foil are 300mm wide and 2.020mm thick. (The density of foil is 2.7 g/cm^3). What maximum length of foil can be made fro
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!