1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krek1111 [17]
3 years ago
12

Nitrogen has the atomic number 7. an isotope of nitrogen containing seven neutrons would be

Chemistry
1 answer:
BigorU [14]3 years ago
8 0
An isotope of nitrogen containing 7 neutrons would be nitrogen-7
You might be interested in
:( plz help and can u guys help me with my math
astra-53 [7]

Answer:

<em>Explanation:</em>

<em>~hybrid is 1 ~</em>

<em>~traits is number 2~</em>

<em>~selecion breading is number 3~</em>

<em>~artificialselection is 4~</em>

~domestic is 5~

hope this helps

<h2>                                       <u>~jimmarion~</u></h2>

3 0
3 years ago
Read 2 more answers
What is the daughter nucleus of pt-199 after a beta decay?
Setler79 [48]

B. At-200

In beta decay the atomic number increases by 1

6 0
3 years ago
In 1986 an electrical power plant in taylorsville, georgia, burned 8,376,726 tons of coal, a national record at that time. assum
RideAnS [48]
<span>C + O2 → CO2 (8,376,726 tons) x (0.80) / (12.01078 g C/mol) x (1 mol CO2/ 1 mol C) x (44.00964 g CO2/mol) = 24,555,054 tons CO2</span>
6 0
3 years ago
Read 2 more answers
Which of the following could be true of two species that have a competitve ralationship in the same ecosystems Help me out pleas
ankoles [38]
The answer is b. as a whole, the species is mutually beneficial to carry on each others traits and exist in the same ecosystem.
6 0
3 years ago
Read 2 more answers
What is the beta decay of uranium-237
Airida [17]
During a phenomenon called beta decay the neutron of the isotope uranium 237 emits/releases an electron causing an increase of atomic number. With the reference of a periodic table the "new" element is Neptunium or Np-237. 
3 0
3 years ago
Other questions:
  • Which of these steps would most likely be part of a lab procedure?
    6·1 answer
  • A(n) ____ is an abbreviation for the name of an element and has either one or two letters.
    6·1 answer
  • An atom is determined to contain 12 protons, 10 electrons, and 12 neutrons. What are the mass number and charge of this atom or
    14·1 answer
  • What element is used in making thermometers
    13·2 answers
  • What is gravity the primary source for ?
    9·2 answers
  • Which molecule, when added to a solution, would give the solution the highest pH
    13·1 answer
  • Which of the following transfers carbon from the nonliving environment to the living environment?
    11·2 answers
  • Question 2 (Multiple Choice Worth 2 points)
    6·1 answer
  • How does voltage work in a circuit?​
    7·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!